View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9164_low_68 (Length: 201)
Name: NF9164_low_68
Description: NF9164
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9164_low_68 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 78 - 188
Target Start/End: Original strand, 31865788 - 31865898
Alignment:
| Q |
78 |
cagtttagttgacatagctttggtgagttgtattcggagagattttaatctctcttcaattaaattgggaagaacttttagtacactgtatacgatcatt |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
31865788 |
cagtttagttgacatagctttggtgagttgtattcggagagattttaatctctcttcaattaaattgggaagaacttttagtacactgtatatgatcatt |
31865887 |
T |
 |
| Q |
178 |
ccttgttattg |
188 |
Q |
| |
|
| ||||||||| |
|
|
| T |
31865888 |
cgttgttattg |
31865898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 15 - 80
Target Start/End: Original strand, 31865275 - 31865339
Alignment:
| Q |
15 |
agagacggaacatttgattcaaggatagctgggcctgccaacaaaaatgttttagtaagttcacag |
80 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
31865275 |
agagacgggacatttgattcaaggatagctgggcctgccaac-aaaatgttttagtaagttcacag |
31865339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University