View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9165_high_10 (Length: 309)
Name: NF9165_high_10
Description: NF9165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9165_high_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 3e-97; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 1 - 188
Target Start/End: Original strand, 42026091 - 42026278
Alignment:
| Q |
1 |
gaatccggtgagggaaccgacgagggaactcgcggtggtcggaggaagaggaaagtttaggatggccactggttttgctcagattagggctcattttctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42026091 |
gaatccggtgagggaaccgacgagggaactcgcggtggtcggaggaagaggaaagtttaggatggccactggttttgctcagattagggctcattttctt |
42026190 |
T |
 |
| Q |
101 |
aatgctacaactggtgatgggatcattgagtataatgtaactgtttttcattattaaaataataaacatcaaatattgttgattaata |
188 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
42026191 |
aatgctacaactggtgatgggatcgttgagtataatgtaactgtttttcattattaaaataataaatatcaaatattgttgattaata |
42026278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 187 - 286
Target Start/End: Original strand, 42026723 - 42026822
Alignment:
| Q |
187 |
taaaatataagcctttggttttcaaattttaactttctattgtttttgtttccctacttccatgtatggagtaaaataaataatcgtgtatggaattaat |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
42026723 |
taaaatataagcctttggttttcaaattttaactttctattgtttttgtttccctgctttcatgtatggaataaaataaataatcgtgtatggaattaat |
42026822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University