View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9165_high_14 (Length: 253)
Name: NF9165_high_14
Description: NF9165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9165_high_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 17 - 235
Target Start/End: Complemental strand, 3856461 - 3856243
Alignment:
| Q |
17 |
agagtacctgataagaggtagaattgaagtcttttgggtttgaaggaacgaaatgttatggaactataannnnnnnnncttataaattttttcggttagg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3856461 |
agagtacctgataagaggtagaattgaagtcttttgggtttgaaggaacgaaatgttatggaactataatttttttttcttataaattttttcggttagg |
3856362 |
T |
 |
| Q |
117 |
tagataactaaatatgatatagtttaatttgatagagatggagcaaaatcagccctctaggtggtaggagataaatatcatgtaagattgtccaactaga |
216 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3856361 |
tagataactaaatatgatatagtttaattagatagagatggagcaaaatcagccctctaggtggtaggagataaatatcatgtaagattgtccaactaga |
3856262 |
T |
 |
| Q |
217 |
tattttttggtgaataata |
235 |
Q |
| |
|
||||||||| ||||||||| |
|
|
| T |
3856261 |
tattttttgctgaataata |
3856243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University