View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9165_high_19 (Length: 216)

Name: NF9165_high_19
Description: NF9165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9165_high_19
NF9165_high_19
[»] chr2 (1 HSPs)
chr2 (11-197)||(10760255-10760441)


Alignment Details
Target: chr2 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 11 - 197
Target Start/End: Complemental strand, 10760441 - 10760255
Alignment:
11 gtttggtgttatagcgaaaagataaagggtagtttaagaacattaaaacatgatcaggaagcataactgtttcccgaattgtgatttggggtggcactgg 110  Q
    ||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
10760441 gtttggtgtgatagcgaaaagataaagggtagtttaagaaaattaaaacatgatcaggaagcaaaactgtttcccgaattgtgatttggggtggcactgg 10760342  T
111 agttggccatttcaaagctgcaattgggatgtgaaatcgagggaggtagaaggggtggatggatgaaataattagggaggtaaagat 197  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10760341 agttggccatttcaaagctgcaattgggatgtgaaatcgagggaggtagaaggggtggatggatgaaataattagggaggtaaagat 10760255  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University