View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9165_high_20 (Length: 211)

Name: NF9165_high_20
Description: NF9165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9165_high_20
NF9165_high_20
[»] chr4 (2 HSPs)
chr4 (33-200)||(23259750-23259917)
chr4 (33-82)||(27543816-27543865)


Alignment Details
Target: chr4 (Bit Score: 160; Significance: 2e-85; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 33 - 200
Target Start/End: Complemental strand, 23259917 - 23259750
Alignment:
33 attgtttttatgttgatcactttattggggatatgatagcaatttaaattatcatatgtagtatcaatgcttttgattgaagaccgtgtgtctacttaca 132  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23259917 attgtttttatgttgatcactttattggggatatgatagcaatttaaattatcatatgtagtatcaatgcttttgattgaagaccgtgtgtctacttaca 23259818  T
133 tcaacacgtgaatacattcgattaatttctttttaaaagttttatgtgttagtgatatatctgatgtc 200  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
23259817 tcaacacgtgattacattcgattaatttctttttaaaagttttatgtgttagtgacatatctgatgtc 23259750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 33 - 82
Target Start/End: Complemental strand, 27543865 - 27543816
Alignment:
33 attgtttttatgttgatcactttattggggatatgatagcaatttaaatt 82  Q
    ||||||||| |||||||||||| || |||| |||||||||||||||||||    
27543865 attgtttttgtgttgatcacttaatcggggttatgatagcaatttaaatt 27543816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University