View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9165_low_10 (Length: 435)
Name: NF9165_low_10
Description: NF9165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9165_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 147; Significance: 2e-77; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 18 - 168
Target Start/End: Complemental strand, 4702550 - 4702400
Alignment:
| Q |
18 |
cagagactagtggtggtatataatgtaacacatattataatattcaatttaactttgattaatttgctctaacaaatcaaatgagagtataaggagtcac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4702550 |
cagagactagtggtggtatataatgtaacacatattataatattcaatttaactttgattaatttgctctaacaaatcaaatgagagtataaggagtcac |
4702451 |
T |
 |
| Q |
118 |
tgcgggaaagaaataaattgtagagattatatttcaatagaacaattataa |
168 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4702450 |
tgcaggaaagaaataaattgtagagattatatttcaatagaacaattataa |
4702400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 133; E-Value: 5e-69
Query Start/End: Original strand, 272 - 404
Target Start/End: Complemental strand, 4702390 - 4702258
Alignment:
| Q |
272 |
ttcttaaccattcaatttattcggaagttccagccacagctagtatgtattgctgtcaaaagaatccgtcaacccctacctggtgtggggcagcaggcca |
371 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4702390 |
ttcttaaccattcaatttattcggaagttccagccacagctagtatgtattgctgtcaaaagaatccgtcaacccctacctggtgtggggcagcaggcca |
4702291 |
T |
 |
| Q |
372 |
gagagcaaaacaggattaggccgcaaaatctct |
404 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
4702290 |
gagagcaaaacaggattaggccgcaaaatctct |
4702258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 175 - 207
Target Start/End: Complemental strand, 4705709 - 4705677
Alignment:
| Q |
175 |
gactaaaataattatgaaaaaagttccaatatt |
207 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
4705709 |
gactaaaataattatggaaaaagttccaatatt |
4705677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University