View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9165_low_31 (Length: 253)

Name: NF9165_low_31
Description: NF9165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9165_low_31
NF9165_low_31
[»] chr5 (1 HSPs)
chr5 (17-235)||(3856243-3856461)


Alignment Details
Target: chr5 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 17 - 235
Target Start/End: Complemental strand, 3856461 - 3856243
Alignment:
17 agagtacctgataagaggtagaattgaagtcttttgggtttgaaggaacgaaatgttatggaactataannnnnnnnncttataaattttttcggttagg 116  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||         ||||||||||||||||||||||    
3856461 agagtacctgataagaggtagaattgaagtcttttgggtttgaaggaacgaaatgttatggaactataatttttttttcttataaattttttcggttagg 3856362  T
117 tagataactaaatatgatatagtttaatttgatagagatggagcaaaatcagccctctaggtggtaggagataaatatcatgtaagattgtccaactaga 216  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3856361 tagataactaaatatgatatagtttaattagatagagatggagcaaaatcagccctctaggtggtaggagataaatatcatgtaagattgtccaactaga 3856262  T
217 tattttttggtgaataata 235  Q
    ||||||||| |||||||||    
3856261 tattttttgctgaataata 3856243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University