View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9165_low_33 (Length: 244)

Name: NF9165_low_33
Description: NF9165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9165_low_33
NF9165_low_33
[»] chr2 (1 HSPs)
chr2 (1-227)||(3341250-3341476)
[»] chr5 (2 HSPs)
chr5 (105-145)||(8349318-8349358)
chr5 (105-145)||(42820263-42820303)


Alignment Details
Target: chr2 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 3341250 - 3341476
Alignment:
1 atgcagtgatatctgatgaaactcacaaattacttaaaacaaattgtgaatttaatagcagtgaagatatattgagtaaggatgatgtatgtaataaagg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
3341250 atgcagtgatatctgatgaaactcacaaattacttaaaacaaattgtgaatttaaaagcagtgaagatatattgagtaaggatgatgtatgtaataaagg 3341349  T
101 attagatgaaatgttcaagcagtacaatgaaattgatatctacagtctttacacccctacttgcttagccaacaaggggatttcaaaaccaatgcaaaag 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
3341350 attagatgaaatgttcaagcagtacaatgaaattgatatctacagtctctacacccctacttgcttagccaacaaggggatttcaaaaccaatgcaaaag 3341449  T
201 gttatgaagcgttcatcaaacaaagac 227  Q
    |||||||||||||||||||||||||||    
3341450 gttatgaagcgttcatcaaacaaagac 3341476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 105 - 145
Target Start/End: Original strand, 8349318 - 8349358
Alignment:
105 gatgaaatgttcaagcagtacaatgaaattgatatctacag 145  Q
    |||||| || |||| ||||||||||||||||||||||||||    
8349318 gatgaagtgctcaaacagtacaatgaaattgatatctacag 8349358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 105 - 145
Target Start/End: Complemental strand, 42820303 - 42820263
Alignment:
105 gatgaaatgttcaagcagtacaatgaaattgatatctacag 145  Q
    |||||| || |||| ||||||||||||||||||||||||||    
42820303 gatgaagtgctcaaacagtacaatgaaattgatatctacag 42820263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University