View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9165_low_39 (Length: 230)
Name: NF9165_low_39
Description: NF9165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9165_low_39 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 37 - 206
Target Start/End: Complemental strand, 3856227 - 3856058
Alignment:
| Q |
37 |
gcatatgttattgttgcgtgatgaatgaagattattgttttaaactgttgtttcgtcatgactctctaccagcggatcttcttcttcccctccaaagtga |
136 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3856227 |
gcatatgttattgttgcgtgaagaatgaagattattgttttaaactgttgtttcgtcatgactctcctccagcggatcttcttcttcccctccaaagtga |
3856128 |
T |
 |
| Q |
137 |
tgcggctggaactttctttatgagagaatagctttatgtttcttctttttcctgttttcttgtttgtaac |
206 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3856127 |
tgcggctggaactttctttctgagagaatagctttatgtttcttctttttcctgttttcttgtttgtaac |
3856058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 125 - 169
Target Start/End: Complemental strand, 50822750 - 50822706
Alignment:
| Q |
125 |
cctccaaagtgatgcggctggaactttctttatgagagaatagct |
169 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||| ||||| |
|
|
| T |
50822750 |
cctccaaagtgatgcggctgaaattttctttttgagagagtagct |
50822706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University