View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9165_low_40 (Length: 216)
Name: NF9165_low_40
Description: NF9165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9165_low_40 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 11 - 197
Target Start/End: Complemental strand, 10760441 - 10760255
Alignment:
| Q |
11 |
gtttggtgttatagcgaaaagataaagggtagtttaagaacattaaaacatgatcaggaagcataactgtttcccgaattgtgatttggggtggcactgg |
110 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
10760441 |
gtttggtgtgatagcgaaaagataaagggtagtttaagaaaattaaaacatgatcaggaagcaaaactgtttcccgaattgtgatttggggtggcactgg |
10760342 |
T |
|
| Q |
111 |
agttggccatttcaaagctgcaattgggatgtgaaatcgagggaggtagaaggggtggatggatgaaataattagggaggtaaagat |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10760341 |
agttggccatttcaaagctgcaattgggatgtgaaatcgagggaggtagaaggggtggatggatgaaataattagggaggtaaagat |
10760255 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University