View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9165_low_42 (Length: 211)
Name: NF9165_low_42
Description: NF9165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9165_low_42 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 160; Significance: 2e-85; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 33 - 200
Target Start/End: Complemental strand, 23259917 - 23259750
Alignment:
| Q |
33 |
attgtttttatgttgatcactttattggggatatgatagcaatttaaattatcatatgtagtatcaatgcttttgattgaagaccgtgtgtctacttaca |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23259917 |
attgtttttatgttgatcactttattggggatatgatagcaatttaaattatcatatgtagtatcaatgcttttgattgaagaccgtgtgtctacttaca |
23259818 |
T |
 |
| Q |
133 |
tcaacacgtgaatacattcgattaatttctttttaaaagttttatgtgttagtgatatatctgatgtc |
200 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
23259817 |
tcaacacgtgattacattcgattaatttctttttaaaagttttatgtgttagtgacatatctgatgtc |
23259750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 33 - 82
Target Start/End: Complemental strand, 27543865 - 27543816
Alignment:
| Q |
33 |
attgtttttatgttgatcactttattggggatatgatagcaatttaaatt |
82 |
Q |
| |
|
||||||||| |||||||||||| || |||| ||||||||||||||||||| |
|
|
| T |
27543865 |
attgtttttgtgttgatcacttaatcggggttatgatagcaatttaaatt |
27543816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University