View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9166_low_35 (Length: 233)
Name: NF9166_low_35
Description: NF9166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9166_low_35 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 12 - 218
Target Start/End: Complemental strand, 17165359 - 17165153
Alignment:
| Q |
12 |
ttattcttataaattcggcttgtgatagttggttatatgggctatttttgaatggtgacaagaccaaacatactggtttaggcactcaaaaatacatttt |
111 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17165359 |
ttattcttataaattcggcttatgatagttggttatatgggctatttttgaatggtgacaagaccaaacatactggtttaggcactcaaaaatacatttt |
17165260 |
T |
 |
| Q |
112 |
taaacaaatttgatattgtgaccatgaaagacttcctatgcttatatttgttaggtggagtggagatattcattttattttttataggcaaattgttggt |
211 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17165259 |
taaacaaatttgatattgtgatcatgaaagacttcctatgcttatatttgttaggtggagtggagatattcattttattttttataggcaaattgttggt |
17165160 |
T |
 |
| Q |
212 |
gttaagt |
218 |
Q |
| |
|
||||||| |
|
|
| T |
17165159 |
gttaagt |
17165153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University