View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9169_high_21 (Length: 264)
Name: NF9169_high_21
Description: NF9169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9169_high_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 5 - 234
Target Start/End: Complemental strand, 42669642 - 42669413
Alignment:
| Q |
5 |
gaggagcagagaaagagcaacgagacaggttgattccgcttgtatggagattacctgtcattcttgtaggcagagattcagaccggcttccgtctaaact |
104 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
42669642 |
gaggatcaaagaaagagcaacgagacaggttgattccgcttgtatggagattacctgtcattcttgtaggcagagattcagaccagcttccgtctaaact |
42669543 |
T |
 |
| Q |
105 |
ctaatattaatctctcgagtcagataagactacaatcagttcaaagctttgttctccttttcctcttttgattctcttaacatatctttgtttaggaaaa |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42669542 |
ctaatattaatctctcgagtcagataagactgcaatcagttcaaagctttgttctcctttccctcttttgattctcttaacatatctttgtttaggaaaa |
42669443 |
T |
 |
| Q |
205 |
aataactcgatcaatattttagttaattaa |
234 |
Q |
| |
|
||||||||||||||||||||| |||||||| |
|
|
| T |
42669442 |
aataactcgatcaatattttaattaattaa |
42669413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University