View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9169_low_33 (Length: 371)
Name: NF9169_low_33
Description: NF9169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9169_low_33 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 308; Significance: 1e-173; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 1 - 355
Target Start/End: Original strand, 39991723 - 39992077
Alignment:
| Q |
1 |
caacaccaacaccaacatgtaaacattggtaacaatttgaggaaatttaattggttgaaaatgatcaaatgtgttggtgtccgacatcaacatctattgg |
100 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||| |
|
|
| T |
39991723 |
caacaccgacaccaacatgtaaacattggtaacaatttgaggaaatttaattggttgaaaatgat-aaatgtgttggtgtccgacatcgacatctattgg |
39991821 |
T |
|
| Q |
101 |
acaccagacatacattcgatctgcagtactgcatatcaaatgtgctctagcatcaaataagggattaagtttagaaaacattatgtcatatcctcaaata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39991822 |
acaccagacatacattcgatctgcagtactgcatatcaaatgtgctctagcatcaaataagggattaagtttagaaaacattatgtcatatcctcaaata |
39991921 |
T |
|
| Q |
201 |
tctctc-nnnnnnnntagaaaagttcaagcttcaaccaattttgcacaagtagttccgacttctgatgtatatgtatttgaagaaccttaaccctattca |
299 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39991922 |
tctctcaaaaaaaaatagaaaagttcaagcttcaaccaattttgcacaagtagttccgacttctgatgtatatgtatttgaagaaccttaaccctattca |
39992021 |
T |
|
| Q |
300 |
tatgctaccaaagcatacaattcatgtccaccaaaccccaaaaaatatcaagtttt |
355 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39992022 |
tatgctaccaaagcatacaattcatgtccaccaaaccccaaaaaatatcaagtttt |
39992077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University