View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9169_low_37 (Length: 329)
Name: NF9169_low_37
Description: NF9169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9169_low_37 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 1e-87; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 75 - 314
Target Start/End: Complemental strand, 22618221 - 22617984
Alignment:
| Q |
75 |
tatctaactacttttatcaatatcattcaccggtaaccgaatcaaccagtttcacactaccaaagagaaagggnnnnnnnntatttatatattcctttcc |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
22618221 |
tatctaactacttttatcaatatcattcaccggtaaccgaatcaaccagtttcacactaccaaagagaaagggaaaaaaaatatttatatattcctttcc |
22618122 |
T |
|
| Q |
175 |
ctcttaaaacgggtcacaaacaaaaagctttgcttccannnnnnnnnnnnncttctccggcgatgctttcactttctccggcgacgttaatctcatcgcc |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22618121 |
ctcttaaaacgggtcacaaacaaaaagctttgcttccactctctctctc--cttctccggcgatgctttcactttctccggcgacgttaatctcatcgcc |
22618024 |
T |
|
| Q |
275 |
gatgatcaattgaactttcgtttcttccttctatgagttt |
314 |
Q |
| |
|
|| ||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
22618023 |
gacgatcaattgaactttcgtttcttccttctctgagttt |
22617984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 15 - 50
Target Start/End: Complemental strand, 22618281 - 22618246
Alignment:
| Q |
15 |
tactactactactatatcagaatagacaacagtgag |
50 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
22618281 |
tactactactactatatcagaatagacaacagtgag |
22618246 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University