View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9169_low_41 (Length: 318)
Name: NF9169_low_41
Description: NF9169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9169_low_41 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 7e-80; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 7e-80
Query Start/End: Original strand, 147 - 301
Target Start/End: Original strand, 54702661 - 54702815
Alignment:
| Q |
147 |
taaacatgcaatatgcatttgaatttatttatttttcaaaactgtgtatctctagatgaagcttgaacactacttctgcacccagtatcagtgcattttc |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54702661 |
taaacatgcaatatgcatttgaatttatttatttttcaaaactgtgtatctctagatgaagcttgaacactacttctgcacccagtatcagtgcattttc |
54702760 |
T |
 |
| Q |
247 |
catttctgaatcatcgtttagctgatgtacacaccccctttgactttgtaccaat |
301 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
54702761 |
catttctgaatcatcgtttagctgatatacacaccccctttgactttgtaccaat |
54702815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 14 - 62
Target Start/End: Original strand, 54702541 - 54702589
Alignment:
| Q |
14 |
cagagagataaacacgttactgacggtatttcagcaattttagcacatg |
62 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
54702541 |
cagagagataaacacgttaccgacagtatttcagcaattttagcacatg |
54702589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University