View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9169_low_46 (Length: 290)
Name: NF9169_low_46
Description: NF9169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9169_low_46 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 11 - 271
Target Start/End: Complemental strand, 52488460 - 52488194
Alignment:
| Q |
11 |
tttggtgttcaacaattagggcattatggttttactaaaataaaataaaattgggcattatggttagtcatgcatgaagcgagtggtgtttcaaatagat |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52488460 |
tttggtgttcaacaattagggcattatggttttactaaaataaaataaaattgggcattatggttagtcatgcatgaagcgagtggtgtttcaaatagat |
52488361 |
T |
 |
| Q |
111 |
catgttggttc-----nnnnnnnngttacagagatcttgttggtttaataacaagag--atatgggnnnnnnnncaaatttgcaaatgcaattctctaat |
203 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
52488360 |
catgttggttctttttttttttttgttacagatatcttgttggtttaataacaagagatatatgggaaaaaaaacaaatttgcaaatgcaattctctaat |
52488261 |
T |
 |
| Q |
204 |
tggtttaataattcttttttcattttgaatctcttggattctcttaaatcgcagattttcctattatc |
271 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52488260 |
tggtttaataattc-tttttcattttgaatctcttggattctcttaaatcgcagattttcctattatc |
52488194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University