View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9169_low_74 (Length: 221)
Name: NF9169_low_74
Description: NF9169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9169_low_74 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 180; Significance: 2e-97; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 15 - 202
Target Start/End: Complemental strand, 5361008 - 5360821
Alignment:
| Q |
15 |
tggtggtgacgaaggtggcggtgaaggacttaaacctggtaccgacggaaaaggaaacaatggtgatgaccctgatggaggtggctgaaatggattattg |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
5361008 |
tggtggtgacgaaggtggcggtgaaggacttaaacctggtaccgacggaaaaggaaacaatggtgatgaccctgatggaggtggcagaaatggattattg |
5360909 |
T |
|
| Q |
115 |
gggactaatggtgttggagttggtggttgaaatgggttaggaatagttggtgtacttggtggttgtaatggattattagggactaatg |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
5360908 |
gggactaatggtgttggagttggtggttgaaatgggttaggaatagttggtgtacttggtggttgtaatggattattagggagtaatg |
5360821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 162 - 202
Target Start/End: Complemental strand, 5360612 - 5360572
Alignment:
| Q |
162 |
tggtgtacttggtggttgtaatggattattagggactaatg |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
5360612 |
tggtgtacttggtggttgtaatggattattaggaactaatg |
5360572 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 170 - 202
Target Start/End: Complemental strand, 5360532 - 5360500
Alignment:
| Q |
170 |
ttggtggttgtaatggattattagggactaatg |
202 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |
|
|
| T |
5360532 |
ttggtggctgtaatggattattagggactaatg |
5360500 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University