View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9169_low_78 (Length: 214)
Name: NF9169_low_78
Description: NF9169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9169_low_78 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 145; Significance: 2e-76; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 21 - 202
Target Start/End: Complemental strand, 1700322 - 1700141
Alignment:
| Q |
21 |
tccgtgtctgtatttatgcttcatattaactcatcattctctcttctcattaatttcagaaaaagttgctgctttatcttctcatcgaggctattttctt |
120 |
Q |
| |
|
||||||||| ||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1700322 |
tccgtgtctatatttgtgctttatattaactcatcattctctcttctcattaatttcagaaaaagttgctgctttatcttctcatcgaggctattttctt |
1700223 |
T |
 |
| Q |
121 |
tgctgtcattgttctaataacaatgttggcacttcatggcactnnnnnnngatcgttaattgttggtgttctttgtgatgtc |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
1700222 |
tgctgtcattgttctaataacaatgttggcacttcatggcactaaaaaaagatcgttaattgttggtgttctatgtgatgtc |
1700141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 71 - 163
Target Start/End: Complemental strand, 1695166 - 1695074
Alignment:
| Q |
71 |
taatttcagaaaaagttgctgctttatcttctcatcgaggctattttctttgctgtcattgttctaataacaatgttggcacttcatggcact |
163 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||| |||||| ||| |||||| |||||||||| ||||||||||||||| | ||||||||| |
|
|
| T |
1695166 |
taatttcagaagaagctgctgctttatcttctcatagaggctgctttttttgctatcattgttctgataacaatgttggcattacatggcact |
1695074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 98 - 202
Target Start/End: Complemental strand, 1684716 - 1684612
Alignment:
| Q |
98 |
cttctcatcgaggctattttctttgctgtcattgttctaataacaatgttggcacttcatggcactnnnnnnngatcgttaattgttggtgttctttgtg |
197 |
Q |
| |
|
|||||| | ||||||||||||||||||| ||||||||| ||||||||||||| | ||||||||||| | || |||||||||||| || |||||| |
|
|
| T |
1684716 |
cttctccttgaggctattttctttgctgccattgttctgataacaatgttggtatttcatggcactaccggcaggtctttaattgttggtattgtttgtg |
1684617 |
T |
 |
| Q |
198 |
atgtc |
202 |
Q |
| |
|
||||| |
|
|
| T |
1684616 |
atgtc |
1684612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University