View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9169_low_81 (Length: 210)
Name: NF9169_low_81
Description: NF9169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9169_low_81 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 49; Significance: 3e-19; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 140 - 209
Target Start/End: Complemental strand, 16428697 - 16428632
Alignment:
| Q |
140 |
atctttctcatcgattgcttttatggttggttggttggttcatgactcgtttcccccaaacccatcgatt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
16428697 |
atctttctcatcgattgcttttatggttggttggtt----catgactggtttcccccaaacccatcgatt |
16428632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 17 - 60
Target Start/End: Complemental strand, 16428751 - 16428708
Alignment:
| Q |
17 |
catcaatcgccgaccatcgattcctccctaaaagcccattgatt |
60 |
Q |
| |
|
|||||||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
16428751 |
catcaatcgctgaccattgattcctccctaaaagcccattgatt |
16428708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 49; Significance: 3e-19; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 140 - 209
Target Start/End: Complemental strand, 15828861 - 15828796
Alignment:
| Q |
140 |
atctttctcatcgattgcttttatggttggttggttggttcatgactcgtttcccccaaacccatcgatt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
15828861 |
atctttctcatcgattgcttttatggttggttggtt----catgactggtttcccccaaacccatcgatt |
15828796 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 140 - 209
Target Start/End: Complemental strand, 10314517 - 10314452
Alignment:
| Q |
140 |
atctttctcatcgattgcttttatggttggttggttggttcatgactcgtttcccccaaacccatcgatt |
209 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
10314517 |
atctttctcatcgattgcttttatgcttggttggtt----catgactggtttcccccaaacccatcgatt |
10314452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 17 - 60
Target Start/End: Complemental strand, 10314571 - 10314528
Alignment:
| Q |
17 |
catcaatcgccgaccatcgattcctccctaaaagcccattgatt |
60 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
10314571 |
catcaatcgccgaccattgattcctccctaaaagcccattgatt |
10314528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 17 - 60
Target Start/End: Complemental strand, 15828915 - 15828872
Alignment:
| Q |
17 |
catcaatcgccgaccatcgattcctccctaaaagcccattgatt |
60 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
15828915 |
catcaatcgccgaccattgattcctccctaaaagcccattgatt |
15828872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University