View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9170_low_15 (Length: 300)
Name: NF9170_low_15
Description: NF9170
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9170_low_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 1 - 279
Target Start/End: Original strand, 27034686 - 27034962
Alignment:
| Q |
1 |
attggcatcgaacacgacactgacacacgtcagacactagatacatcttctactatagagaaaatttatctttttgtaattgtcaatctttcatatcttg |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27034686 |
attggcatcgaacacgac--tgacacacgtcagacaccagatacatcttctactatagagaaaatttatctttttgtaattgtcaatctttcatatcttg |
27034783 |
T |
|
| Q |
101 |
tgtcataagtaatagtagtattttgaattaagaggttaggttcaaatgattaatgagttccaacgaaagtcaaatcgatcagagtacccaagttcaagct |
200 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
27034784 |
tgtcataagtaatagtagtattctgaattaagaggttaggttcaaatgattaatgagttccaacgaaagtcaaatcgatcagagtacccgagttcaagct |
27034883 |
T |
|
| Q |
201 |
ttggttggaacaataagttgtcatactttattcacctctttgccaaactcgggatttataggaagtcaggaaccatttc |
279 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
27034884 |
ttggttggaacaataagttgtcgtactttattcacctctttgccgaactcaggatttataggaagtcaggaaccatttc |
27034962 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University