View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9170_low_24 (Length: 249)
Name: NF9170_low_24
Description: NF9170
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9170_low_24 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 7 - 249
Target Start/End: Complemental strand, 34099759 - 34099517
Alignment:
| Q |
7 |
gcaattacaatttccaacatgcattcatcaaagcagattaaaagaaaaactgataaacaataactttcatggagtatgcattttcccctgtgataatagc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||| ||| |
|
|
| T |
34099759 |
gcaattacaatttccaacatgcattcatcaaagcagattaaaagaagaactgataaacaataactttcaaggagtatgcattttcccctgtgatagaagc |
34099660 |
T |
 |
| Q |
107 |
aaggataaactcttgtaaggggttattatggatagattgaaacacaacaaaatataaatcatccatgaagcctaaaaactccttacaatacaaccaaaaa |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
34099659 |
aaggataaactcttgtaaggggttattatggatagattgaaatacaacaaaatataaatcatccatgaagcctaaaaactccttacaataaaaccaaaaa |
34099560 |
T |
 |
| Q |
207 |
agcaggtgtaacattgcacgagcaaataaatttctaagcacac |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34099559 |
agcaggtgtaacattgcacgagcaaataaatttctaagcacac |
34099517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University