View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9170_low_28 (Length: 246)
Name: NF9170_low_28
Description: NF9170
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9170_low_28 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 18 - 143
Target Start/End: Complemental strand, 2625298 - 2625175
Alignment:
| Q |
18 |
atcagggggtcagttttgtggatattcttcgcgcaatgcgagaagttcccggaaaagggagatttggtcccctctctatccaactgggcgagtcggtttg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||| |||||| ||||||||||||||| ||||||||||| |
|
|
| T |
2625298 |
atcagggggtcagttttgtggatattcttcgcgcaatgcaagaagttcccggaaaaggcagattcggtccc--ctctatccaactgggtgagtcggtttg |
2625201 |
T |
 |
| Q |
118 |
taagagtctctggccgatattcccac |
143 |
Q |
| |
|
|||||||||||| ||||||||||||| |
|
|
| T |
2625200 |
taagagtctctgtccgatattcccac |
2625175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 180 - 238
Target Start/End: Complemental strand, 31772896 - 31772838
Alignment:
| Q |
180 |
gctggttcggttttcaacccagaaagggtctgggtccagctcggccatccgagatataa |
238 |
Q |
| |
|
|||| |||||||||||||| |||||||||| |||||||||||| ||||| ||||||||| |
|
|
| T |
31772896 |
gctgattcggttttcaacctagaaagggtcggggtccagctcgcccatctgagatataa |
31772838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University