View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9170_low_30 (Length: 237)
Name: NF9170_low_30
Description: NF9170
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9170_low_30 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 15 - 228
Target Start/End: Original strand, 31438797 - 31439010
Alignment:
| Q |
15 |
acatcaccatctctcccttctcaaacactcatcccccaccttaaaacctctctctctaaaaccctatcaatcttccccccacttgctggccgttttgtga |
114 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31438797 |
acatcgccatctctcccttctcaaacactcgtcccccaccttaaaacctctctctctaaaaccctatcaatcttccccccacttgctggccgttttgtga |
31438896 |
T |
 |
| Q |
115 |
ccgactctgccggtcacatctttatcacatgcaatgacgctggcgtagatttcatccatgccagcgccacggatctcactatcactcaccttttatcacc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31438897 |
ccgactctgccggtcacatctttatcacatgcaatgactctggcgtagatttcatccatgccagcgccacggatctcactatcactcaccttttatcacc |
31438996 |
T |
 |
| Q |
215 |
acctgatgtccatc |
228 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
31438997 |
acctgatgtccatc |
31439010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University