View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9170_low_31 (Length: 233)
Name: NF9170_low_31
Description: NF9170
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9170_low_31 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 129; Significance: 7e-67; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 1 - 178
Target Start/End: Complemental strand, 30432087 - 30431900
Alignment:
| Q |
1 |
cgggaaggggctctttggaaagatgcgctaatagagaaatatggttttggagtgacgaggtggg----------gatgtggagtggccgagacatacatc |
90 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
30432087 |
cgggaaggggctctttggaaagatgcgctaatagagaaatatggttttggagtgatgaggtggatggaggtggagatgtggagtggccgagacatacatc |
30431988 |
T |
|
| Q |
91 |
aaggtggtggaaaaatattgttaatttagatatgtttggtgggcaaggttggtttaatccggaggttgtgagaagggtagggaacagt |
178 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
30431987 |
aaggtagtggaaaaatattgttaattttgatatgtttggtgggcaaggttggtttaatccgtaggttttgagaagggtagggaacagt |
30431900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University