View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9170_low_31 (Length: 233)

Name: NF9170_low_31
Description: NF9170
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9170_low_31
NF9170_low_31
[»] chr2 (1 HSPs)
chr2 (1-178)||(30431900-30432087)


Alignment Details
Target: chr2 (Bit Score: 129; Significance: 7e-67; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 1 - 178
Target Start/End: Complemental strand, 30432087 - 30431900
Alignment:
1 cgggaaggggctctttggaaagatgcgctaatagagaaatatggttttggagtgacgaggtggg----------gatgtggagtggccgagacatacatc 90  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||           ||||||||||||||||||||||||||    
30432087 cgggaaggggctctttggaaagatgcgctaatagagaaatatggttttggagtgatgaggtggatggaggtggagatgtggagtggccgagacatacatc 30431988  T
91 aaggtggtggaaaaatattgttaatttagatatgtttggtgggcaaggttggtttaatccggaggttgtgagaagggtagggaacagt 178  Q
    ||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||    
30431987 aaggtagtggaaaaatattgttaattttgatatgtttggtgggcaaggttggtttaatccgtaggttttgagaagggtagggaacagt 30431900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University