View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9171_high_2 (Length: 461)
Name: NF9171_high_2
Description: NF9171
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9171_high_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 362; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 362; E-Value: 0
Query Start/End: Original strand, 19 - 443
Target Start/End: Original strand, 36059714 - 36060134
Alignment:
| Q |
19 |
tgggagtcttgcgatatccaaacgcacgattcgggagacacaccttatcataatcaattctaaattttttactatagtgttttgtaactaatcttgtctt |
118 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
36059714 |
tgggagtcttacgatatccaaacgcacgactcgggagacacaccttatcataatcaattctaaatttttgactatagtgttttgtaactaatcttgtctt |
36059813 |
T |
|
| Q |
119 |
gcatattttgaatttcccgtgacattcttctttgccttgcacattctcttgacatcagtagtccaatgctcttttagaagaaagattagttaccacatat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36059814 |
gcatattttgaatttcccgtgacattcttctttgccttgcacattctcttgacatcagtagtccaatgctcttttagaagaaagattagttaccacatat |
36059913 |
T |
|
| Q |
219 |
cattttggcttttatttctc-agttttttcatagagatcttcaagtattaatggtgataaggcttctgcattgtcaaagagatgttgaagacttcctata |
317 |
Q |
| |
|
|||||||||||||||||||| | |||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36059914 |
cattttggcttttatttctcaattttttttatagagatcttcaagtattcatggtgataaggcttctgcattgtcaaagagatgttgaagacttcctata |
36060013 |
T |
|
| Q |
318 |
tgtatcatgatcctttcactctaagtgtcttcataagtgggcaatgttggtgagtatggcacttattgaacttttatagatgtttcttcttcaaattcta |
417 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
36060014 |
tgtatcatgatcctttcactctaagtgtcttcataagtgggcaatgttggtgagtatggcacttattgaacttctatagatgtttcttct-----ttcta |
36060108 |
T |
|
| Q |
418 |
aaaataaaatgtatttcttattgtga |
443 |
Q |
| |
|
||||||||||||| ||||||||||| |
|
|
| T |
36060109 |
aaaataaaatgtacctcttattgtga |
36060134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University