View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9171_low_9 (Length: 269)
Name: NF9171_low_9
Description: NF9171
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9171_low_9 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 5 - 269
Target Start/End: Complemental strand, 41716780 - 41716516
Alignment:
| Q |
5 |
aatccattatcaccccacttcgcgtcaaattatattctgttcaccttggatatctgggaggaaaacttaggtattttttgcagtgtcctgtttacaagaa |
104 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41716780 |
aatccattatcaccccactttgcgtcaaattatattctgttcaccttggatatctgggaggaaaacttaggtattttttgcagtgtcctgtttacaagaa |
41716681 |
T |
|
| Q |
105 |
tatgtgggttgtctcattttatttagttggtttattagtcttgggcaatttcgtctcagcgttaaaaaactaccacatatgtgtggctcaaaggaagatt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
41716680 |
tatgtgggttgtctcattttatttagttggtttattagtcttgggcaatttcgtctcagcattaaaaaactaccgcatatgtgtggctcaaaggaagatt |
41716581 |
T |
|
| Q |
205 |
tggcaataggtcatatgacaatcaaagttggcaataggtccacatcattttattgtttcttctgt |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41716580 |
tggcaataggtcatatgacaatcaaagttggcaataggtccacatcattttattgtttcttctgt |
41716516 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University