View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9173_high_12 (Length: 219)
Name: NF9173_high_12
Description: NF9173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9173_high_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 24 - 203
Target Start/End: Original strand, 31003520 - 31003699
Alignment:
| Q |
24 |
ggagataccacttacgcgtcacttaaacatgctcaacggacgaagctatgcattttcaaagtcatatcttaaacgagttatgtgcataaacactagaatt |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31003520 |
ggagataccacttacgcgtcacttaaacatgctcaacggacgaagctatgcattttcgaagtcatatcttaaacgagttatgtgcataaacactagaatt |
31003619 |
T |
 |
| Q |
124 |
ttataggctggaaaatggtggccaccaactcggaaaatcagaacagttatgatcaccgcgaactcttcatgtaccaccaa |
203 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
31003620 |
ttataggctggaaaatggtgtccaccaactcggaaaatcagagtagttacgatcaccgcgaactcttcatgtaccaccaa |
31003699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University