View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9173_high_12 (Length: 219)

Name: NF9173_high_12
Description: NF9173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9173_high_12
NF9173_high_12
[»] chr5 (1 HSPs)
chr5 (24-203)||(31003520-31003699)


Alignment Details
Target: chr5 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 24 - 203
Target Start/End: Original strand, 31003520 - 31003699
Alignment:
24 ggagataccacttacgcgtcacttaaacatgctcaacggacgaagctatgcattttcaaagtcatatcttaaacgagttatgtgcataaacactagaatt 123  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
31003520 ggagataccacttacgcgtcacttaaacatgctcaacggacgaagctatgcattttcgaagtcatatcttaaacgagttatgtgcataaacactagaatt 31003619  T
124 ttataggctggaaaatggtggccaccaactcggaaaatcagaacagttatgatcaccgcgaactcttcatgtaccaccaa 203  Q
    |||||||||||||||||||| |||||||||||||||||||||  ||||| ||||||||||||||||||||||||||||||    
31003620 ttataggctggaaaatggtgtccaccaactcggaaaatcagagtagttacgatcaccgcgaactcttcatgtaccaccaa 31003699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University