View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9173_high_7 (Length: 393)
Name: NF9173_high_7
Description: NF9173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9173_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 241; Significance: 1e-133; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 126 - 386
Target Start/End: Complemental strand, 45991912 - 45991653
Alignment:
| Q |
126 |
catagaccagcctcttgcacttgctaaggaacccactagcctgcatgtttcagtccttgccattggtgtataccctctaaactctatcatttgtacaatc |
225 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45991912 |
catagaccaacctcttgcacttgctaaggaacccactagcctgcatgtttcagtccttgccattggtgtataccctctaaactctatcatttgtacaatc |
45991813 |
T |
 |
| Q |
226 |
ctcatcagttgcattcctttcttcataacaaggatcacttaacaaaatattcatcaatggtgtgttggaggtgtcttatagcatcatggatatgtttgta |
325 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
45991812 |
ctcatcagttgcattcctttcttcataacaaggatcacttaacaaaatattcatcaatggtgtgttggaggtgtcttatagcatcatgggtatgtttgta |
45991713 |
T |
 |
| Q |
326 |
ccactccaaacttcttcatgtaccttcacccccaaaatgaatgtagtgtgtttctctgctt |
386 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
45991712 |
ccactccaaacttcttcatgtaccttca-ccccaaaatgaatgtagtgtgtttctttgctt |
45991653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 19 - 67
Target Start/End: Complemental strand, 45991957 - 45991909
Alignment:
| Q |
19 |
gttgtagcttgcatatacacaacatatccaaatttgcatcttgtgcata |
67 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
45991957 |
gttgtagcttgcatatacacaacatatccaaatgtgcatcttgtgcata |
45991909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 117 - 187
Target Start/End: Complemental strand, 45981256 - 45981186
Alignment:
| Q |
117 |
taggagaaacatagaccagcctcttgcacttgctaaggaacccactagcctgcatgtttcagtccttgcca |
187 |
Q |
| |
|
|||| ||||||||||||| || ||||||||||||||||| || || ||||||||||||||||||||| |
|
|
| T |
45981256 |
taggtgaaacatagaccaaacttttgcacttgctaaggaaaccgttaatgtgcatgtttcagtccttgcca |
45981186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University