View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9173_low_28 (Length: 294)
Name: NF9173_low_28
Description: NF9173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9173_low_28 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 238; Significance: 1e-132; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 16 - 276
Target Start/End: Complemental strand, 24933913 - 24933652
Alignment:
| Q |
16 |
aatacttgaaaggaattgatacctgagggagaca-ggttagagcagcaagagaagagtgtaagaggcagattactgaaaccgtcggcagagaagatagtg |
114 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24933913 |
aatactcgaaaggaattgatacctgagggagacaaggttagagcagcaagagaagagtgtaagaggcagattactgaaaccgtcggcagagaagatagtg |
24933814 |
T |
|
| Q |
115 |
agatgaaactcctcaaggtggggtccaatggcagtactgatccacgtgtcaattgagtgcccggcgaacggatcgggatagatatgatcgcatgagagac |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24933813 |
agatgaaactcctcaaggtggggtccaatggcagtactgatccacgtgtcaattgaatgcccagcgaacggatcgggatagatatgatcgcatgagagac |
24933714 |
T |
|
| Q |
215 |
ggaacttccgaatgacgcgtgagcgacgaagagagaggacagttttgacgaaaacggtgaac |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
24933713 |
ggaacttccgaatgacgcgtgagcgacgaagagagaggacagtgttgacgaaaacggtgaac |
24933652 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 208 - 276
Target Start/End: Complemental strand, 26026577 - 26026509
Alignment:
| Q |
208 |
gagagacggaacttccgaatgacgcgtgagcgacgaagagagaggacagttttgacgaaaacggtgaac |
276 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
26026577 |
gagagacggaacttccgaacgacgcgtgagcgacggagagagaggacagtgttgacgaaaacggtgaac |
26026509 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University