View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9173_low_30 (Length: 273)
Name: NF9173_low_30
Description: NF9173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9173_low_30 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 169; Significance: 1e-90; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 1 - 213
Target Start/End: Original strand, 24998146 - 24998358
Alignment:
| Q |
1 |
atggtccttaactatggtttaaggaccatggttaaattgtttttcttgagggagcagcattacatggtggactctcagtgagattgaaaacaagaaagaa |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
24998146 |
atggtccttaactatggttcaaggaccatggttaaattgtttttctcgagggagcagcattacatggtggactctcagtgagattgaaaacagaaaagaa |
24998245 |
T |
|
| Q |
101 |
acgggtagggagggagattagtgtggtagataagggtgcgttcactgcacatacatgaaccggcgagactcaagcatgagaacaaatgtcactcacgtag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||| |||||||| | |||||| | |
|
|
| T |
24998246 |
acgggtagggagggagattagtgtggtagataagggtgcattcactacacatacatgaaccggcgagactcaagcatgaaaacaaatgacgctcacgcaa |
24998345 |
T |
|
| Q |
201 |
tggaaattggcat |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
24998346 |
tggaaattggcat |
24998358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 165 - 255
Target Start/End: Complemental strand, 24997949 - 24997859
Alignment:
| Q |
165 |
gagactcaagcatgagaacaaatgtcactcacgtagtggaaattggcatgaaagagcgaggaagtagtataagcaagcttgacggtggaaa |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| | ||||||||||||||||||||| ||||||| |
|
|
| T |
24997949 |
gagactcaagcatgagaacaaatgtcactcatgtagtggaaattggcatgaaagagcgaagtagtagtataagcaagcttgacagtggaaa |
24997859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 115 - 161
Target Start/End: Complemental strand, 24998052 - 24998006
Alignment:
| Q |
115 |
agattagtgtggtagataagggtgcgttcactgcacatacatgaacc |
161 |
Q |
| |
|
||||||||||||| |||||||||||| |||||| ||||||||||||| |
|
|
| T |
24998052 |
agattagtgtggtggataagggtgcgctcactgtacatacatgaacc |
24998006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University