View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9173_low_30 (Length: 273)

Name: NF9173_low_30
Description: NF9173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9173_low_30
NF9173_low_30
[»] chr6 (3 HSPs)
chr6 (1-213)||(24998146-24998358)
chr6 (165-255)||(24997859-24997949)
chr6 (115-161)||(24998006-24998052)


Alignment Details
Target: chr6 (Bit Score: 169; Significance: 1e-90; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 1 - 213
Target Start/End: Original strand, 24998146 - 24998358
Alignment:
1 atggtccttaactatggtttaaggaccatggttaaattgtttttcttgagggagcagcattacatggtggactctcagtgagattgaaaacaagaaagaa 100  Q
    ||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||  ||||||    
24998146 atggtccttaactatggttcaaggaccatggttaaattgtttttctcgagggagcagcattacatggtggactctcagtgagattgaaaacagaaaagaa 24998245  T
101 acgggtagggagggagattagtgtggtagataagggtgcgttcactgcacatacatgaaccggcgagactcaagcatgagaacaaatgtcactcacgtag 200  Q
    ||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||| |||||||| | |||||| |     
24998246 acgggtagggagggagattagtgtggtagataagggtgcattcactacacatacatgaaccggcgagactcaagcatgaaaacaaatgacgctcacgcaa 24998345  T
201 tggaaattggcat 213  Q
    |||||||||||||    
24998346 tggaaattggcat 24998358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 165 - 255
Target Start/End: Complemental strand, 24997949 - 24997859
Alignment:
165 gagactcaagcatgagaacaaatgtcactcacgtagtggaaattggcatgaaagagcgaggaagtagtataagcaagcttgacggtggaaa 255  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| | ||||||||||||||||||||| |||||||    
24997949 gagactcaagcatgagaacaaatgtcactcatgtagtggaaattggcatgaaagagcgaagtagtagtataagcaagcttgacagtggaaa 24997859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 115 - 161
Target Start/End: Complemental strand, 24998052 - 24998006
Alignment:
115 agattagtgtggtagataagggtgcgttcactgcacatacatgaacc 161  Q
    ||||||||||||| |||||||||||| |||||| |||||||||||||    
24998052 agattagtgtggtggataagggtgcgctcactgtacatacatgaacc 24998006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University