View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9173_low_32 (Length: 233)
Name: NF9173_low_32
Description: NF9173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9173_low_32 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 8 - 215
Target Start/End: Original strand, 7017753 - 7017960
Alignment:
| Q |
8 |
gagaagcagagacagaatcaaccatgttttagtctcacaacccatctgatctatgagtagaatacctatctattattaataaaggatacgtgatatgtat |
107 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7017753 |
gagaagaagagacagaatcaaccatgttttagtctcacaacccatctgatctatgagtagaatacctatctattattaataaaggatacgtgatatgtat |
7017852 |
T |
 |
| Q |
108 |
gaaatatgtgatctgattaatagaggatatgattttatgatttatttatatgcacttatcgaatttttgttttgttttgatctatgagtagcatgcatat |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7017853 |
gaaatatgtgatctgattaatagaggatatgattttatgatttatttatatgcacttatcgaatttttgttttgttttgatctatgagtagcatgcatat |
7017952 |
T |
 |
| Q |
208 |
atagagat |
215 |
Q |
| |
|
|||||||| |
|
|
| T |
7017953 |
atagagat |
7017960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University