View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9176_low_13 (Length: 203)
Name: NF9176_low_13
Description: NF9176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9176_low_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 107; Significance: 8e-54; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 23 - 184
Target Start/End: Original strand, 31528720 - 31528882
Alignment:
| Q |
23 |
agttgaagtgttaaagtttgactaaaaagttcaggagg-tactnnnnnnnnttaattacatattttataattgttataaattatgaaatagtttatcaat |
121 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31528720 |
agttgaagtgtcaaagtttggctaaaaagttcaggagggtactaaaaaaaattaattacatattttataattgttataaattatgaaatagtttatcaat |
31528819 |
T |
 |
| Q |
122 |
tggagaaattttttagttaatcggacaatataagacaagtttgaaaacccttcaaattagaag |
184 |
Q |
| |
|
||||||| |||||||||||||| ||||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
31528820 |
tggagaatttttttagttaatcagacaatataagacaagtttgaaaactctttaaattagaag |
31528882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University