View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9176_low_3 (Length: 517)
Name: NF9176_low_3
Description: NF9176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9176_low_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 386; Significance: 0; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 386; E-Value: 0
Query Start/End: Original strand, 13 - 495
Target Start/End: Original strand, 37637884 - 37638391
Alignment:
| Q |
13 |
tttcgtgtttggcatatgatttgcattgtaattttactagattgcactaactctctccagttctcaaattaggcaataattgaggaatgttacaacttat |
112 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37637884 |
tttcgtgttcggcatatgatttgcattgtaattttactagattgcactaactccctccagttctcaaattaggcaataattgaggaatgttacaacttat |
37637983 |
T |
 |
| Q |
113 |
aactgcaattattagtagtatcttggatggctagcttctggcttcattacattaagttgtt--gagtacattagactaatggacgtggttgtttttgtct |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37637984 |
aactgcaattattagtagtatcttggatggctagcttctggcttcattacattaagttgttaagagtacattagactaatggacgtggttgtttttgtct |
37638083 |
T |
 |
| Q |
211 |
aatctatttc-----tggtaagtacaaccagctttcatttctagatagcaaatttattagaaattatgatttcatatttttacgcttcccctttctatcc |
305 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37638084 |
aatctatttccctcatggtaagtacaaccagctttcatttctagatagcaaatttattagaaattatgatttcatatttttacgcttcccctttctatcc |
37638183 |
T |
 |
| Q |
306 |
tcgtctcgtgtcaaggacagggaagatgcagctagggatgtgtatcagttgctttataatttaagccaaacaactatccgcgttttcagtgaa------- |
398 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37638184 |
tcgtctcgtgtcaaggacagggaagatgtagctagggatgtgtatcagttgctttataatttaagccaaacaactatccgcgttttcagtgaagctagga |
37638283 |
T |
 |
| Q |
399 |
-----------gctagaaataccaacttcttaaaatcacattgaattctgcatagggacactagattatatcacctaacacaaatccaaacgaaccataa |
487 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||| ||||||||||||||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
37638284 |
ataccaacttcgctaggaataccaacttcttaaaatctcattgaattttgcatagggacactagaatatatcacctaacacaaatccaaacaaaccataa |
37638383 |
T |
 |
| Q |
488 |
gtagtctt |
495 |
Q |
| |
|
|||||||| |
|
|
| T |
37638384 |
gtagtctt |
37638391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 13 - 111
Target Start/End: Complemental strand, 37813631 - 37813537
Alignment:
| Q |
13 |
tttcgtgtttggcatatgatttgcattgtaattttactagattgcactaactctctccagttctcaaattaggcaataattgaggaatgttacaactta |
111 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||| | ||||||| ||||| | |||| ||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
37813631 |
tttcatgtttggcatatgatttgcattataattt----atattgcaccaactcctttcagtcctcaaattaagtaataattgaggaatgttacaactta |
37813537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 51; Significance: 5e-20; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 376 - 466
Target Start/End: Complemental strand, 12788767 - 12788677
Alignment:
| Q |
376 |
caactatccgcgttttcagtgaagctagaaataccaacttcttaaaatcacattgaattctgcatagggacactagattatatcacctaac |
466 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||| |||||||||||||| ||||| | ||||||||||| ||| ||||||||||||| |
|
|
| T |
12788767 |
caactatccgcgtttgcagtgaagctaggaataccagcttcttaaaatcacgttgaactttgcatagggacgtgagaatatatcacctaac |
12788677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 392 - 478
Target Start/End: Complemental strand, 12123661 - 12123576
Alignment:
| Q |
392 |
cagtgaagctagaaataccaacttcttaaaatcacattgaattctgcatagggacactagattatatcacctaacacaaatccaaac |
478 |
Q |
| |
|
||||||| |||| ||||||| |||||||||||||| ||||| | |||||| |||| | ||| ||||||||| |||| ||||||||| |
|
|
| T |
12123661 |
cagtgaaactaggaataccagcttcttaaaatcactttgaact-tgcataaggacgcaagaatatatcaccagacaccaatccaaac |
12123576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University