View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9180_high_1 (Length: 588)
Name: NF9180_high_1
Description: NF9180
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9180_high_1 |
 |  |
|
| [»] scaffold0048 (1 HSPs) |
 |  |  |
|
| [»] scaffold0189 (1 HSPs) |
 |  |  |
|
| [»] scaffold0179 (2 HSPs) |
 |  |  |
|
| [»] scaffold0061 (1 HSPs) |
 |  |  |
|
| [»] scaffold0017 (1 HSPs) |
 |  |  |
|
| [»] scaffold0155 (1 HSPs) |
 |  |  |
|
| [»] scaffold0016 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 278; Significance: 1e-155; HSPs: 9)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 1 - 346
Target Start/End: Complemental strand, 7713097 - 7712759
Alignment:
| Q |
1 |
tgtttaaagatctagatcgtttaataatggtttgtaatagctaacgacaacagtttttctacttatctaaaattaagtattgttttaagtgtgtaatatt |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7713097 |
tgtttaaagatctacatcgtttaataatggtttgtaatagctaacgacaacagtttttctacttatctaaaattaagtattgttttaagtgtgtaatatt |
7712998 |
T |
 |
| Q |
101 |
tgttatagtattatgttttaaattatccgtgaatgaatatgcaatacttcataaagtattcgtgtcatgcatcatgaatcacaaagtcataatgaatcac |
200 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7712997 |
tgttattgtattatgttttaaattatccgtgaatgaatatgcaatacttcataaagtattcgtgtcatgcat-----atcacaaagtcataatgaatcac |
7712903 |
T |
 |
| Q |
201 |
tatgttttaactcgtttgttttatgtttaatcttgcgattattttaaaatatacgaacgcatagaaatgatcaaagaatatttttgaatttaagtacatc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||| |||||||||||||||||||||||| | |
|
|
| T |
7712902 |
tatgttttaactcgtttgttttatgtttaatcttgcgattcttttaaaatatacgaaagcaaagaaatgatcagagaatatttttgaatttaagtacagc |
7712803 |
T |
 |
| Q |
301 |
tactaaccaaaaataggctaccttttttatatttcaatatgttgaa |
346 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
7712802 |
tactaacc-aaaataggcta-cttttttatatttcaatgtgttgaa |
7712759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 444 - 542
Target Start/End: Original strand, 27218589 - 27218687
Alignment:
| Q |
444 |
aatttaatttagctttgctaggtaagtggtgttggatgatgttggttgactaaggtgggttacggtatagggttttggtggcgagatatggtgaggagg |
542 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||||| | ||||| | || |||||| || |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
27218589 |
aatttaatttagctttgttaggtaaatggtgttggcggttgttgatagatagaggtggattttggtatagggtgttggtggcgagatatggtgaggagg |
27218687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 422 - 542
Target Start/End: Complemental strand, 23887778 - 23887658
Alignment:
| Q |
422 |
ttggggttgagatagttgagagaatttaatttagctttgctaggtaagtggtgttggatgatgttggttgactaaggtgggttacggtatagggttttgg |
521 |
Q |
| |
|
|||||| | ||| ||||||| || |||||| |||||||| |||| || |||||||||| |||| |||| ||| ||||| ||| ||||||||||||||| |
|
|
| T |
23887778 |
ttgggggtcagacagttgagggagtttaatatagctttgttaggaaaatggtgttggaggatgctggtagacagaggtgagttctggtatagggttttgg |
23887679 |
T |
 |
| Q |
522 |
tggcgagatatggtgaggagg |
542 |
Q |
| |
|
|| ||| || |||||||||| |
|
|
| T |
23887678 |
cggtgaggtacggtgaggagg |
23887658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 422 - 542
Target Start/End: Complemental strand, 23898954 - 23898834
Alignment:
| Q |
422 |
ttggggttgagatagttgagagaatttaatttagctttgctaggtaagtggtgttggatgatgttggttgactaaggtgggttacggtatagggttttgg |
521 |
Q |
| |
|
|||||| | ||| ||||||| || |||||| |||||||| |||| || |||||||||| |||| |||| ||| ||||| ||| ||||||||||||||| |
|
|
| T |
23898954 |
ttgggggtcagacagttgagggagtttaatatagctttgttaggaaaatggtgttggaggatgctggtagacagaggtgagttctggtatagggttttgg |
23898855 |
T |
 |
| Q |
522 |
tggcgagatatggtgaggagg |
542 |
Q |
| |
|
|| ||| || |||||||||| |
|
|
| T |
23898854 |
cggtgaggtacggtgaggagg |
23898834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 507 - 547
Target Start/End: Original strand, 41805288 - 41805328
Alignment:
| Q |
507 |
ggtatagggttttggtggcgagatatggtgaggaggatggg |
547 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
41805288 |
ggtatagggtgttggtggcgagatatggtgaggaggttggg |
41805328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 507 - 548
Target Start/End: Original strand, 8752926 - 8752967
Alignment:
| Q |
507 |
ggtatagggttttggtggcgagatatggtgaggaggatggga |
548 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
8752926 |
ggtatagggtgctggtggcgagatatggtgaggaggctggga |
8752967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 507 - 548
Target Start/End: Complemental strand, 17056139 - 17056098
Alignment:
| Q |
507 |
ggtatagggttttggtggcgagatatggtgaggaggatggga |
548 |
Q |
| |
|
|||||||||| ||||||||| | ||||||||||||||||||| |
|
|
| T |
17056139 |
ggtatagggtgttggtggcgcgttatggtgaggaggatggga |
17056098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 507 - 548
Target Start/End: Original strand, 25018848 - 25018889
Alignment:
| Q |
507 |
ggtatagggttttggtggcgagatatggtgaggaggatggga |
548 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||| ||||| |
|
|
| T |
25018848 |
ggtatagggtgttggtggcaagatatggtgaggaggctggga |
25018889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 408 - 484
Target Start/End: Complemental strand, 4077977 - 4077901
Alignment:
| Q |
408 |
aggagtatgggggtttggggttgagatagttgagagaatttaatttagctttgctaggtaagtggtgttggatgatg |
484 |
Q |
| |
|
|||||| ||| ||||||||| ||||| |||||| ||||||||||| ||||| |||| ||||| ||||||| |||| |
|
|
| T |
4077977 |
aggagtttggaggtttgggggtgagacagttgaaggaatttaatttggctttcttaggaaagtgatgttggaggatg |
4077901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 78; Significance: 5e-36; HSPs: 17)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 78; E-Value: 5e-36
Query Start/End: Original strand, 384 - 546
Target Start/End: Complemental strand, 18381783 - 18381629
Alignment:
| Q |
384 |
cttggagctatgtttgttcgcgagaggagtatgggggtttggggttgagatagttgagagaatttaatttagctttgctaggtaagtggtgttggatgat |
483 |
Q |
| |
|
||||||||||||||||||| ||| |||||||| ||||| |||| |||||||||| |||||||||||||||||||||||||||||||||| || |
|
|
| T |
18381783 |
cttggagctatgtttgttctcgaaaggagtataggggt--------gagacagttgagagactttaatttagctttgctaggtaagtggtgttggagaat |
18381692 |
T |
 |
| Q |
484 |
gttggttgactaaggtgggttacggtatagggttttggtggcgagatatggtgaggaggatgg |
546 |
Q |
| |
|
||||||||| ||| |||||| ||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
18381691 |
gttggttgatagaggagggttatggtattgggttttggtggcgagatatggtgacgaggatgg |
18381629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 396 - 542
Target Start/End: Complemental strand, 55367330 - 55367185
Alignment:
| Q |
396 |
tttgttcgcgagaggagtatgggggtttggggttgagatagttgagagaatttaatttagctttgctaggtaagtggtgttggatgatgttggttgacta |
495 |
Q |
| |
|
||||||| ||| ||||||||||||||| ||||| ||| |||||| ||||||||| | || ||| |||| || |||||||||| |||||| ||||| |
|
|
| T |
55367330 |
tttgttcacgaaaggagtatgggggttgggggt-gaggaagttgaaggaatttaatcttgcgttgttaggaaaatggtgttggaggatgttagttgatag |
55367232 |
T |
 |
| Q |
496 |
aggtgggttacggtatagggttttggtggcgagatatggtgaggagg |
542 |
Q |
| |
|
||||||||| |||||| ||||||| | ||||||||||||||||||| |
|
|
| T |
55367231 |
aggtgggttgtggtataaggttttgttagcgagatatggtgaggagg |
55367185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 507 - 569
Target Start/End: Complemental strand, 48930336 - 48930274
Alignment:
| Q |
507 |
ggtatagggttttggtggcgagatatggtgaggaggatgggaagttagaagtaaggggctgga |
569 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||| || || ||||||||| |
|
|
| T |
48930336 |
ggtatagggttttggtggcgagatatggtgaggaggatgggaggttggaggttgggggctgga |
48930274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 443 - 542
Target Start/End: Complemental strand, 19875917 - 19875818
Alignment:
| Q |
443 |
gaatttaatttagctttgctaggtaagtggtgttggatgatgttggttgactaaggtgggttacggtatagggttttggtggcgagatatggtgaggagg |
542 |
Q |
| |
|
|||||||||||||||||| | |||| ||||||||| | ||||| | || ||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
19875917 |
gaatttaatttagctttgatgagtaaatggtgttggcggttgttgatagatagaggtgggttttggtatagggtgttggtggcgagatatggtgaggagg |
19875818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 507 - 548
Target Start/End: Original strand, 52250654 - 52250695
Alignment:
| Q |
507 |
ggtatagggttttggtggcgagatatggtgaggaggatggga |
548 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
52250654 |
ggtatagggtgttggtggcgagatatggtgaggaggatggga |
52250695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 409 - 484
Target Start/End: Complemental strand, 47537976 - 47537901
Alignment:
| Q |
409 |
ggagtatgggggtttggggttgagatagttgagagaatttaatttagctttgctaggtaagtggtgttggatgatg |
484 |
Q |
| |
|
||||| ||| ||||||||| ||||| ||||| |||||||||||| |||||| |||||||||| ||||||| |||| |
|
|
| T |
47537976 |
ggagtttggaggtttgggggtgagacggttgaaagaatttaatttggctttgttaggtaagtgttgttggaggatg |
47537901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 443 - 493
Target Start/End: Original strand, 7581643 - 7581693
Alignment:
| Q |
443 |
gaatttaatttagctttgctaggtaagtggtgttggatgatgttggttgac |
493 |
Q |
| |
|
||||||||||||||||| ||||| |||||| |||||| ||||||||||||| |
|
|
| T |
7581643 |
gaatttaatttagctttactagggaagtggagttggaggatgttggttgac |
7581693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 394 - 542
Target Start/End: Complemental strand, 31675654 - 31675506
Alignment:
| Q |
394 |
tgtttgttcgcgagaggagtatgggggtttggggttgagatagttgagagaatttaatttagctttgctaggtaagtggtgttggatgatgttggttgac |
493 |
Q |
| |
|
|||||||| ||| |||||||||| || || ||| ||||| ||||||| || ||||| |||||| ||||||| ||||||||| |||||||| || |
|
|
| T |
31675654 |
tgtttgtttacgaaaggagtatggagggttaggggtgagacagttgagggagtttaaccatgctttgttaggtaaatggtgttggcgaatgttggtggat |
31675555 |
T |
 |
| Q |
494 |
taaggtgggttacggtatagggttttggtggcgagatatggtgaggagg |
542 |
Q |
| |
|
|||||| || |||||||||| |||||| ||||||||||||||||| |
|
|
| T |
31675554 |
agaggtggtttttggtatagggtgctggtggtgagatatggtgaggagg |
31675506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 384 - 548
Target Start/End: Complemental strand, 34830126 - 34829962
Alignment:
| Q |
384 |
cttggagctatgtttgttcgcgagaggagtatgggggtttggggttgagatagttgagagaatttaatttagctttgctaggtaagtggtgttggatgat |
483 |
Q |
| |
|
||||||||| |||||||| || |||||||||| || |||||| |||| ||||| ||||||||| |||||| ||||||| ||||||||| ||| |
|
|
| T |
34830126 |
cttggagctctgtttgtttacgtaaggagtatggagggttgggggtgaggaagttgcatgaatttaatagtgctttgttaggtaaatggtgttggcggat |
34830027 |
T |
 |
| Q |
484 |
gttggttgactaaggtgggttacggtatagggttttggtggcgagatatggtgaggaggatggga |
548 |
Q |
| |
|
|||||| || || ||||||| |||||||||| ||| ||| ||||||||||| | ||||||| |
|
|
| T |
34830026 |
gttggtggatatagttgggttatggtatagggtactggcagcgcgatatggtgagaaagatggga |
34829962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 446 - 492
Target Start/End: Complemental strand, 36731580 - 36731534
Alignment:
| Q |
446 |
tttaatttagctttgctaggtaagtggtgttggatgatgttggttga |
492 |
Q |
| |
|
|||||| |||||||| |||| ||||||||||||| |||||||||||| |
|
|
| T |
36731580 |
tttaatgtagctttgttaggaaagtggtgttggaggatgttggttga |
36731534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 507 - 548
Target Start/End: Complemental strand, 6825432 - 6825391
Alignment:
| Q |
507 |
ggtatagggttttggtggcgagatatggtgaggaggatggga |
548 |
Q |
| |
|
|||||||||| ||||||||| | ||||||||||||||||||| |
|
|
| T |
6825432 |
ggtatagggtgttggtggcgcggtatggtgaggaggatggga |
6825391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 446 - 519
Target Start/End: Complemental strand, 29310079 - 29310006
Alignment:
| Q |
446 |
tttaatttagctttgctaggtaagtggtgttggatgatgttggttgactaaggtgggttacggtatagggtttt |
519 |
Q |
| |
|
||||||||||| ||| |||| || ||||||||| ||||||||| ||| ||||||| || ||||||||||||| |
|
|
| T |
29310079 |
tttaatttagcattgttaggaaaatggtgttggcggatgttggtggacaaaggtggtttgtggtatagggtttt |
29310006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 408 - 493
Target Start/End: Original strand, 30166775 - 30166860
Alignment:
| Q |
408 |
aggagtatgggggtttggggttgagatagttgagagaatttaatttagctttgctaggtaagtggtgttggatgatgttggttgac |
493 |
Q |
| |
|
||||| |||| ||||||||| |||| |||||| ||||||||| |||||| ||||||| ||||||||| ||||||||||||| |
|
|
| T |
30166775 |
aggagaatggaggtttgggggtgaggcagttgaaggaatttaatagtgctttgttaggtaaatggtgttggcggatgttggttgac |
30166860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 507 - 548
Target Start/End: Complemental strand, 44888514 - 44888473
Alignment:
| Q |
507 |
ggtatagggttttggtggcgagatatggtgaggaggatggga |
548 |
Q |
| |
|
|||||||||| ||||||||| | ||||||||||||||||||| |
|
|
| T |
44888514 |
ggtatagggtgttggtggcgcgttatggtgaggaggatggga |
44888473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 394 - 542
Target Start/End: Original strand, 31920768 - 31920916
Alignment:
| Q |
394 |
tgtttgttcgcgagaggagtatgggggtttggggttgagatagttgagagaatttaatttagctttgctaggtaagtggtgttggatgatgttggttgac |
493 |
Q |
| |
|
|||||||| ||| |||||||||| || || || ||||| ||||||| || ||||| |||||| ||||||| ||||||||| |||||||| || |
|
|
| T |
31920768 |
tgtttgtttacgaaaggagtatggagggttaggagtgagacagttgagggagtttaaccatgctttgttaggtaaatggtgttggcgaatgttggtggat |
31920867 |
T |
 |
| Q |
494 |
taaggtgggttacggtatagggttttggtggcgagatatggtgaggagg |
542 |
Q |
| |
|
|||||| || |||||||||| |||||| ||||||||||||||||| |
|
|
| T |
31920868 |
agaggtggtttttggtatagggtgctggtggtgagatatggtgaggagg |
31920916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 408 - 516
Target Start/End: Original strand, 40513155 - 40513263
Alignment:
| Q |
408 |
aggagtatgggggtttggggttgagatagttgagagaatttaatttagctttgctaggtaagtggtgttggatgatgttggttgactaaggtgggttacg |
507 |
Q |
| |
|
|||||||||||||||||||| |||| ||||| || |||||| |||||| ||||||| ||||||||| ||||||||| || |||||| ||| | |
|
|
| T |
40513155 |
aggagtatgggggtttgggggtgaggaagttgcaggattttaatagtgctttgttaggtaaatggtgttggcggatgttggtggatagaggtggtttatg |
40513254 |
T |
 |
| Q |
508 |
gtatagggt |
516 |
Q |
| |
|
||||||||| |
|
|
| T |
40513255 |
gtatagggt |
40513263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 408 - 484
Target Start/End: Complemental strand, 50544932 - 50544856
Alignment:
| Q |
408 |
aggagtatgggggtttggggttgagatagttgagagaatttaatttagctttgctaggtaagtggtgttggatgatg |
484 |
Q |
| |
|
|||||| ||| ||||| ||| ||| | |||||| ||||||||||| |||||| |||| ||||||||||||| |||| |
|
|
| T |
50544932 |
aggagtctggaggtttaggggtgacacagttgaaggaatttaatttggctttgttaggaaagtggtgttggaggatg |
50544856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 48; Significance: 4e-18; HSPs: 9)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 408 - 547
Target Start/End: Complemental strand, 12341276 - 12341137
Alignment:
| Q |
408 |
aggagtatgggggtttggggttgagatagttgagagaatttaatttagctttgctaggtaagtggtgttggatgatgttggttgactaaggtgggttacg |
507 |
Q |
| |
|
||||| |||||||||||||| ||||| |||||| ||||||||| | |||||| |||| ||||||||||||| |||||| || || ||| ||||| | |
|
|
| T |
12341276 |
aggagaatgggggtttgggggtgagacagttgaaggaatttaatatggctttgttaggaaagtggtgttggaggatgttagtggatagaggagggttgtg |
12341177 |
T |
 |
| Q |
508 |
gtatagggttttggtggcgagatatggtgaggaggatggg |
547 |
Q |
| |
|
|| |||||| |||||||||| ||||||||||||| |||| |
|
|
| T |
12341176 |
gtttagggtactggtggcgaggtatggtgaggaggctggg |
12341137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 470 - 541
Target Start/End: Original strand, 29721403 - 29721474
Alignment:
| Q |
470 |
tggtgttggatgatgttggttgactaaggtgggttacggtatagggttttggtggcgagatatggtgaggag |
541 |
Q |
| |
|
|||||||||| |||||| ||||| |||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
29721403 |
tggtgttggaggatgttagttgatcaaggtgggttgtggtatagggttttggtggcgagatatggtgaggag |
29721474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 416 - 547
Target Start/End: Complemental strand, 36025222 - 36025091
Alignment:
| Q |
416 |
gggggtttggggttgagatagttgagagaatttaatttagctttgctaggtaagtggtgttggatgatgttggttgactaaggtgggttacggtataggg |
515 |
Q |
| |
|
||||| |||||| |||| ||||||| ||||||||| | ||||| |||| | ||||||||| ||||||||| || ||| |||||| ||||||| | |
|
|
| T |
36025222 |
gggggattgggggtgaggcagttgagtgaatttaatattgctttattaggataatggtgttggcggatgttggtggatagaggagggttatggtatagag |
36025123 |
T |
 |
| Q |
516 |
ttttggtggcgagatatggtgaggaggatggg |
547 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |
|
|
| T |
36025122 |
ttttggtggcgagatatggtgaggaggctggg |
36025091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 408 - 514
Target Start/End: Complemental strand, 7453061 - 7452955
Alignment:
| Q |
408 |
aggagtatgggggtttggggttgagatagttgagagaatttaatttagctttgctaggtaagtggtgttggatgatgttggttgactaaggtgggttacg |
507 |
Q |
| |
|
|||||||||| ||||||||| ||||| |||||| ||||||||| |||||| ||||||||||||||||| ||||||||| ||| |||||| || | |
|
|
| T |
7453061 |
aggagtatggaggtttgggggtgagacagttgaatgaatttaatagtgctttgttaggtaagtggtgttggcggatgttggtggacagaggtggtttgtg |
7452962 |
T |
 |
| Q |
508 |
gtatagg |
514 |
Q |
| |
|
||||||| |
|
|
| T |
7452961 |
gtatagg |
7452955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 507 - 548
Target Start/End: Complemental strand, 12332458 - 12332417
Alignment:
| Q |
507 |
ggtatagggttttggtggcgagatatggtgaggaggatggga |
548 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
12332458 |
ggtatagggtgttggtggcgagatatggtgaggaggatggga |
12332417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 507 - 548
Target Start/End: Complemental strand, 36492991 - 36492950
Alignment:
| Q |
507 |
ggtatagggttttggtggcgagatatggtgaggaggatggga |
548 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
36492991 |
ggtatagggtgttggtggcgaggtatggtgaggaggatggga |
36492950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 408 - 547
Target Start/End: Original strand, 37165552 - 37165691
Alignment:
| Q |
408 |
aggagtatgggggtttggggttgagatagttgagagaatttaatttagctttgctaggtaagtggtgttggatgatgttggttgactaaggtgggttacg |
507 |
Q |
| |
|
||||| |||||||||||||| |||| ||||| ||||||||| | ||| | |||| ||||| ||||||| |||||| || || ||| || || | |
|
|
| T |
37165552 |
aggagaatgggggtttgggggtgaggcggttgaaggaatttaatattgctctattaggaaagtgatgttggaggatgttagtggatagaggaggcttgtg |
37165651 |
T |
 |
| Q |
508 |
gtatagggttttggtggcgagatatggtgaggaggatggg |
547 |
Q |
| |
|
||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
37165652 |
gtatagggtactggtggcgagatatggcgaggaggatggg |
37165691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 409 - 492
Target Start/End: Original strand, 45255267 - 45255350
Alignment:
| Q |
409 |
ggagtatgggggtttggggttgagatagttgagagaatttaatttagctttgctaggtaagtggtgttggatgatgttggttga |
492 |
Q |
| |
|
||||| ||| ||||||||| ||||| |||| |||||||||||| |||||| |||||||||| ||||||| | |||| ||||| |
|
|
| T |
45255267 |
ggagtttggaggtttgggggtgagacggttggaagaatttaatttggctttgttaggtaagtgatgttggaggttgttagttga |
45255350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 436 - 484
Target Start/End: Complemental strand, 17659512 - 17659464
Alignment:
| Q |
436 |
gttgagagaatttaatttagctttgctaggtaagtggtgttggatgatg |
484 |
Q |
| |
|
||||| |||||||||| | |||||| |||||||||||||||||| |||| |
|
|
| T |
17659512 |
gttgaaagaatttaatgtggctttgttaggtaagtggtgttggaggatg |
17659464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 48; Significance: 4e-18; HSPs: 9)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 422 - 541
Target Start/End: Original strand, 19014429 - 19014548
Alignment:
| Q |
422 |
ttggggttgagatagttgagagaatttaatttagctttgctaggtaagtggtgttggatgatgttggttgactaaggtgggttacggtatagggttttgg |
521 |
Q |
| |
|
|||||| | ||| ||||||| || ||||||||||||||||||||||| ||| ||||| ||||||||| ||| ||||||||| ||||| || |||| |
|
|
| T |
19014429 |
ttgggggttagacagttgagggagtttaatttagctttgctaggtaaatggagttggcggatgttggtggacagaggtgggttttggtattaagtgttgg |
19014528 |
T |
 |
| Q |
522 |
tggcgagatatggtgaggag |
541 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
19014529 |
tggcgagatatggtgaggag |
19014548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 384 - 542
Target Start/End: Original strand, 1247993 - 1248151
Alignment:
| Q |
384 |
cttggagctatgtttgttcgcgagaggagtatgggggtttggggttgagatagttgagagaatttaatttagctttgctaggtaagtggtgttggatgat |
483 |
Q |
| |
|
||||||||| |||||||| | | ||||||||||||| || ||| |||| |||| || || |||||| |||||| ||||||| | ||||||| || |
|
|
| T |
1247993 |
cttggagctctgtttgtttacaaaaggagtatggggggttaggggtgaggcagttaagggagtttaatagtgctttgttaggtaaatagtgttggtgtat |
1248092 |
T |
 |
| Q |
484 |
gttggttgactaaggtgggttacggtatagggttttggtggcgagatatggtgaggagg |
542 |
Q |
| |
|
||||| || ||||||| || |||||||| | ||||||||||||||||||||||||| |
|
|
| T |
1248093 |
attggtggataaaggtggtttttggtataggctgttggtggcgagatatggtgaggagg |
1248151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 507 - 548
Target Start/End: Complemental strand, 45270851 - 45270810
Alignment:
| Q |
507 |
ggtatagggttttggtggcgagatatggtgaggaggatggga |
548 |
Q |
| |
|
|||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
45270851 |
ggtataggattttggtggcgagatatgatgaggaggatggga |
45270810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 409 - 484
Target Start/End: Complemental strand, 26721341 - 26721266
Alignment:
| Q |
409 |
ggagtatgggggtttggggttgagatagttgagagaatttaatttagctttgctaggtaagtggtgttggatgatg |
484 |
Q |
| |
|
||||| ||| ||||||||| ||||| |||||||||| || ||||| |||||| ||| ||||||||||||| |||| |
|
|
| T |
26721341 |
ggagtttggtggtttgggggtgagacagttgagagagttcaatttggctttgttagaaaagtggtgttggaggatg |
26721266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 443 - 542
Target Start/End: Complemental strand, 28358563 - 28358465
Alignment:
| Q |
443 |
gaatttaatttagctttgctaggtaagtggtgttggatgatgttggttgactaaggtgggttacggtatagggttttggtggcgagatatggtgaggagg |
542 |
Q |
| |
|
||||||||||||||||| | ||||| |||||||||| ||||||| || ||| ||||| |||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
28358563 |
gaatttaatttagcttta-tgggtaaatggtgttggagattgttggtagatagaggcgggttttggtacagggtgttggtggcgagatatggtgaggagg |
28358465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 408 - 519
Target Start/End: Original strand, 32352741 - 32352852
Alignment:
| Q |
408 |
aggagtatgggggtttggggttgagatagttgagagaatttaatttagctttgctaggtaagtggtgttggatgatgttggttgactaaggtgggttacg |
507 |
Q |
| |
|
|||||||||| ||||||||| |||| | |||| || ||||||||||||||| |||| || ||||||||| ||||||||| || |||||| || | |
|
|
| T |
32352741 |
aggagtatggcggtttgggggtgaggaaattgaaggagtttaatttagctttgttaggaaaatggtgttggcggatgttggtggatagaggtggtttgtg |
32352840 |
T |
 |
| Q |
508 |
gtatagggtttt |
519 |
Q |
| |
|
|||||||||||| |
|
|
| T |
32352841 |
gtatagggtttt |
32352852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 507 - 548
Target Start/End: Original strand, 22191312 - 22191353
Alignment:
| Q |
507 |
ggtatagggttttggtggcgagatatggtgaggaggatggga |
548 |
Q |
| |
|
|||||||||| ||||||||| | ||||||||||||||||||| |
|
|
| T |
22191312 |
ggtatagggtgttggtggcgtgttatggtgaggaggatggga |
22191353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 436 - 489
Target Start/End: Complemental strand, 39430958 - 39430905
Alignment:
| Q |
436 |
gttgagagaatttaatttagctttgctaggtaagtggtgttggatgatgttggt |
489 |
Q |
| |
|
|||||| || ||||||| |||||| |||||||||||||||||| ||||||||| |
|
|
| T |
39430958 |
gttgagggagtttaattgtgctttgttaggtaagtggtgttggaggatgttggt |
39430905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 443 - 548
Target Start/End: Complemental strand, 52692145 - 52692040
Alignment:
| Q |
443 |
gaatttaatttagctttgctaggtaagtggtgttggatgatgttggttgactaaggtgggttacggtatagggttttggtggcgagatatggtgaggagg |
542 |
Q |
| |
|
|||||||||| ||||| |||| || |||||||||| ||||||||| || || ||||| |||||||||| ||||||||| | ||||||||||||| |
|
|
| T |
52692145 |
gaatttaattgtgctttattaggaaaatggtgttggaggatgttggtggatagagaggggttctggtatagggtgttggtggcgcggtatggtgaggagg |
52692046 |
T |
 |
| Q |
543 |
atggga |
548 |
Q |
| |
|
||||| |
|
|
| T |
52692045 |
ctggga |
52692040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 44; Significance: 9e-16; HSPs: 11)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 443 - 542
Target Start/End: Complemental strand, 19350618 - 19350519
Alignment:
| Q |
443 |
gaatttaatttagctttgctaggtaagtggtgttggatgatgttggttgactaaggtgggttacggtatagggttttggtggcgagatatggtgaggagg |
542 |
Q |
| |
|
|||||||||||||||||| | ||||| ||||||||| | ||||| | || ||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
19350618 |
gaatttaatttagctttgatgggtaaatggtgttggcggttgttgatagatagaggtgggttttggtatagggtgttggtggcgagatatggtgaggagg |
19350519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 408 - 542
Target Start/End: Original strand, 29976439 - 29976573
Alignment:
| Q |
408 |
aggagtatgggggtttggggttgagatagttgagagaatttaatttagctttgctaggtaagtggtgttggatgatgttggttgactaaggtgggttacg |
507 |
Q |
| |
|
|||||| ||| ||| ||||| |||| ||||| | |||||||||||||||||| | ||||| ||| ||||| | ||||| | || ||||||||| | |
|
|
| T |
29976439 |
aggagtttggaggtctgggggtgaggcagttgcgggaatttaatttagctttgatgggtaaatggcgttggcggttgttgatagatagaggtgggttttg |
29976538 |
T |
 |
| Q |
508 |
gtatagggttttggtggcgagatatggtgaggagg |
542 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |
|
|
| T |
29976539 |
gtatagggtgttggtggcgagatatggtgaggagg |
29976573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 507 - 548
Target Start/End: Complemental strand, 10362743 - 10362702
Alignment:
| Q |
507 |
ggtatagggttttggtggcgagatatggtgaggaggatggga |
548 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10362743 |
ggtatagggttttggtggcgagatatggtgaggaggatggga |
10362702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 507 - 548
Target Start/End: Complemental strand, 34434870 - 34434829
Alignment:
| Q |
507 |
ggtatagggttttggtggcgagatatggtgaggaggatggga |
548 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34434870 |
ggtatagggttttggtggcgagatatggtgaggaggatggga |
34434829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 408 - 537
Target Start/End: Complemental strand, 15674538 - 15674409
Alignment:
| Q |
408 |
aggagtatgggggtttggggttgagatagttgagagaatttaatttagctttgctaggtaagtggtgttggatgatgttggttgactaaggtgggttacg |
507 |
Q |
| |
|
|||||||||| ||||||||| || | | |||| || ||||||||||||||| |||| || ||||||||| ||||||||| ||| || ||| || | |
|
|
| T |
15674538 |
aggagtatggcggtttgggggtgcggaaattgaaggagtttaatttagctttgttaggaaaatggtgttggcggatgttggtggaccgagatggtttgtg |
15674439 |
T |
 |
| Q |
508 |
gtatagggttttggtggcgagatatggtga |
537 |
Q |
| |
|
|||||||||||| || || ||||||||||| |
|
|
| T |
15674438 |
gtatagggttttagtcgccagatatggtga |
15674409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 435 - 548
Target Start/End: Complemental strand, 32186365 - 32186252
Alignment:
| Q |
435 |
agttgagagaatttaatttagctttgctaggtaagtggtgttggatgatgttggttgactaaggtgggttacggtatagggttttggtggcgagatatgg |
534 |
Q |
| |
|
|||| ||||| ||||||||||| ||| | | ||| ||||||||| | ||||||| || ||||||||| |||||||||| ||||||||||||||| | |
|
|
| T |
32186365 |
agtttagagagtttaatttagccttgttggataaatggtgttggcagttgttggtggatagaggtgggttttggtatagggtgttggtggcgagatatag |
32186266 |
T |
 |
| Q |
535 |
tgaggaggatggga |
548 |
Q |
| |
|
||||| || ||||| |
|
|
| T |
32186265 |
tgaggtggctggga |
32186252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 409 - 484
Target Start/End: Original strand, 11060294 - 11060369
Alignment:
| Q |
409 |
ggagtatgggggtttggggttgagatagttgagagaatttaatttagctttgctaggtaagtggtgttggatgatg |
484 |
Q |
| |
|
||||| ||| ||||||||| ||||| ||||| |||||||||| | | |||| |||||||||||||||||| |||| |
|
|
| T |
11060294 |
ggagtttggaggtttgggggtgagacggttgaaagaatttaatgtggttttgttaggtaagtggtgttggaggatg |
11060369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 468 - 542
Target Start/End: Original strand, 10919955 - 10920029
Alignment:
| Q |
468 |
agtggtgttggatgatgttggttgactaaggtgggttacggtatagggttttggtggcgagatatggtgaggagg |
542 |
Q |
| |
|
|||||||||||| |||||||||||| ||| ||||| |||||||||| ||||| || || ||||||||||||| |
|
|
| T |
10919955 |
agtggtgttggaggatgttggttgatagaggggggttttggtatagggtgttggttgctaggtatggtgaggagg |
10920029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 435 - 489
Target Start/End: Complemental strand, 11469250 - 11469196
Alignment:
| Q |
435 |
agttgagagaatttaatttagctttgctaggtaagtggtgttggatgatgttggt |
489 |
Q |
| |
|
|||||| ||| |||||| |||| ||||||||||| |||||||||| ||||||||| |
|
|
| T |
11469250 |
agttgaaagagtttaatatagcattgctaggtaaatggtgttggaggatgttggt |
11469196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 443 - 548
Target Start/End: Complemental strand, 25350896 - 25350791
Alignment:
| Q |
443 |
gaatttaatttagctttgctaggtaagtggtgttggatgatgttggttgactaaggtgggttacggtatagggttttggtggcgagatatggtgaggagg |
542 |
Q |
| |
|
|||||||||| ||||| |||| || |||| ||||| ||||||||| || || |||||| |||||||||| ||||||||| | ||||||||||||| |
|
|
| T |
25350896 |
gaatttaattgtgctttattaggaaaatggttttggaggatgttggtggatagagatgggttctggtatagggtgttggtggcgcggtatggtgaggagg |
25350797 |
T |
 |
| Q |
543 |
atggga |
548 |
Q |
| |
|
||||| |
|
|
| T |
25350796 |
ctggga |
25350791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 384 - 543
Target Start/End: Original strand, 13563343 - 13563503
Alignment:
| Q |
384 |
cttggagctatgtttgttcgcgagaggagtatgggggtttggggttgagatagttgagagaatttaatttagctttgctaggtaagtggtgttggatgat |
483 |
Q |
| |
|
|||||||| || | ||||| ||| |||||||||||||| |||| |||| | |||| || |||||| | |||||||||||||||| ||| |||| ||| |
|
|
| T |
13563343 |
cttggagcgatatatgttctcgaaaggagtatgggggtctgggtgtgaggcaactgagggagtttaatcttgctttgctaggtaagttgtgctggaggat |
13563442 |
T |
 |
| Q |
484 |
gttggttgactaaggtgggttacggt-atagggttttggtggcgagatatggtgaggagga |
543 |
Q |
| |
|
| | ||||| |||||||||| ||| |||| || || ||||| |||||| | |||||||| |
|
|
| T |
13563443 |
gctagttgatagaggtgggttatggtaatagagtctttgtggcaagatattgagaggagga |
13563503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 41; Significance: 0.00000000000006; HSPs: 7)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 410 - 542
Target Start/End: Complemental strand, 2072247 - 2072115
Alignment:
| Q |
410 |
gagtatgggggtttggggttgagatagttgagagaatttaatttagctttgctaggtaagtggtgttggatgatgttggttgactaaggtgggttacggt |
509 |
Q |
| |
|
|||||||| | ||||||||||||| ||||||| | ||||||| | ||||| ||||||| ||||| ||| ||||||||| || ||| ||| | ||| |
|
|
| T |
2072247 |
gagtatggagatttggggttgagacagttgaggggatttaatattgctttattaggtaaatggtgatggcagatgttggtggatagaggagggatgtggt |
2072148 |
T |
 |
| Q |
510 |
atagggttttggtggcgagatatggtgaggagg |
542 |
Q |
| |
|
||||||| |||||||||||||||||||||||| |
|
|
| T |
2072147 |
atagggtgctggtggcgagatatggtgaggagg |
2072115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 409 - 484
Target Start/End: Original strand, 10562765 - 10562840
Alignment:
| Q |
409 |
ggagtatgggggtttggggttgagatagttgagagaatttaatttagctttgctaggtaagtggtgttggatgatg |
484 |
Q |
| |
|
||||| ||| ||||||||| ||||| |||||| |||||||||||| |||||| |||| ||||||||||||| |||| |
|
|
| T |
10562765 |
ggagtttggaggtttgggggtgagacagttgaaagaatttaatttggctttgttaggaaagtggtgttggaggatg |
10562840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 203 - 324
Target Start/End: Original strand, 4607257 - 4607379
Alignment:
| Q |
203 |
tgttttaactcgtttgttttatgtttaatcttgcgattattttaaaatatacgaacgcatagaaatgatcaaagaatatttttgaatttaagtacatcta |
302 |
Q |
| |
|
||||||||||| |||| |||||||||||||||| ||||||||| |||| || || | |||||| |||||| | ||| ||||||| || |||||| | | |
|
|
| T |
4607257 |
tgttttaactcatttgctttatgtttaatcttgtgattattttgaaatgtatcaaagagtagaaaggatcaaggcatacttttgaacttgagtacaacca |
4607356 |
T |
 |
| Q |
303 |
cta-accaaaaataggctacctt |
324 |
Q |
| |
|
||| |||||||| || ||||||| |
|
|
| T |
4607357 |
ctagaccaaaaacagcctacctt |
4607379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 404 - 477
Target Start/End: Original strand, 56336928 - 56337000
Alignment:
| Q |
404 |
cgagaggagtatgggggtttggggttgagatagttgagagaatttaatttagctttgctaggtaagtggtgttg |
477 |
Q |
| |
|
||||||||| ||||||||||||||| ||| ||||||| ||||||||| | |||||| |||| ||||||||||| |
|
|
| T |
56336928 |
cgagaggagaatgggggtttggggt-gaggcagttgagggaatttaatcttgctttgttaggaaagtggtgttg |
56337000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 446 - 519
Target Start/End: Complemental strand, 20675693 - 20675620
Alignment:
| Q |
446 |
tttaatttagctttgctaggtaagtggtgttggatgatgttggttgactaaggtgggttacggtatagggtttt |
519 |
Q |
| |
|
||||||||||||||| |||| || ||||||||| ||||||||| ||| |||||| || ||||||||||||| |
|
|
| T |
20675693 |
tttaatttagctttgttaggaaaatggtgttggcggatgttggtggacagaggtggtttgtggtatagggtttt |
20675620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 507 - 548
Target Start/End: Complemental strand, 38296316 - 38296275
Alignment:
| Q |
507 |
ggtatagggttttggtggcgagatatggtgaggaggatggga |
548 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| | |||||| |
|
|
| T |
38296316 |
ggtatagggtgttggtggcgagatatggtgaggtgaatggga |
38296275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 514 - 542
Target Start/End: Original strand, 52617402 - 52617430
Alignment:
| Q |
514 |
ggttttggtggcgagatatggtgaggagg |
542 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
52617402 |
ggttttggtggcgagatatggtgaggagg |
52617430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 7)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 409 - 484
Target Start/End: Original strand, 7000219 - 7000294
Alignment:
| Q |
409 |
ggagtatgggggtttggggttgagatagttgagagaatttaatttagctttgctaggtaagtggtgttggatgatg |
484 |
Q |
| |
|
||||| ||| ||||||||| ||||| |||||| |||||||||||| ||||| |||||||||||||||||| |||| |
|
|
| T |
7000219 |
ggagtttggaggtttgggggtgagacagttgaaagaatttaatttgcctttgttaggtaagtggtgttggaggatg |
7000294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 409 - 484
Target Start/End: Original strand, 20208152 - 20208227
Alignment:
| Q |
409 |
ggagtatgggggtttggggttgagatagttgagagaatttaatttagctttgctaggtaagtggtgttggatgatg |
484 |
Q |
| |
|
||||| ||| ||||||||| ||||| |||||||||| || ||||| |||||| |||| ||||||||||||| |||| |
|
|
| T |
20208152 |
ggagtttggtggtttgggggtgagacagttgagagagttcaatttggctttgttaggaaagtggtgttggaggatg |
20208227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 507 - 548
Target Start/End: Original strand, 4297839 - 4297880
Alignment:
| Q |
507 |
ggtatagggttttggtggcgagatatggtgaggaggatggga |
548 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
4297839 |
ggtatagggtgttggtggcgaggtatggtgaggaggatggga |
4297880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 507 - 548
Target Start/End: Complemental strand, 41590706 - 41590665
Alignment:
| Q |
507 |
ggtatagggttttggtggcgagatatggtgaggaggatggga |
548 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
41590706 |
ggtatagggtgttggtggcgaggtatggtgaggaggatggga |
41590665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 453 - 533
Target Start/End: Original strand, 22174470 - 22174550
Alignment:
| Q |
453 |
tagctttgctaggtaagtggtgttggatgatgttggttgactaaggtgggttacggtatagggttttggtggcgagatatg |
533 |
Q |
| |
|
|||||||| |||||| |||||||||| | ||||||| || |||||||||| ||||||| || |||||||||||||||| |
|
|
| T |
22174470 |
tagctttgttaggtagatggtgttggaggttgttggtggatagaggtgggttatggtatagagtgttggtggcgagatatg |
22174550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 446 - 492
Target Start/End: Original strand, 39351897 - 39351943
Alignment:
| Q |
446 |
tttaatttagctttgctaggtaagtggtgttggatgatgttggttga |
492 |
Q |
| |
|
||||||||| ||||| | |||||||||||||||||||||||| |||| |
|
|
| T |
39351897 |
tttaatttatctttgttgggtaagtggtgttggatgatgttgattga |
39351943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 443 - 492
Target Start/End: Complemental strand, 27529531 - 27529482
Alignment:
| Q |
443 |
gaatttaatttagctttgctaggtaagtggtgttggatgatgttggttga |
492 |
Q |
| |
|
|||||||||||||| || ||||| |||||| |||||| |||||||||||| |
|
|
| T |
27529531 |
gaatttaatttagcattactagggaagtggagttggaggatgttggttga |
27529482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0048 (Bit Score: 36; Significance: 0.00000000005; HSPs: 1)
Name: scaffold0048
Description:
Target: scaffold0048; HSP #1
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 435 - 542
Target Start/End: Original strand, 63757 - 63864
Alignment:
| Q |
435 |
agttgagagaatttaatttagctttgctaggtaagtggtgttggatgatgttggttgactaaggtgggttacggtatagggttttggtggcgagatatgg |
534 |
Q |
| |
|
||||||| || |||||||||||||||||||| || ||||||||| ||||||| | ||| ||| | || ||||||| || |||||||||||||||| |
|
|
| T |
63757 |
agttgagggagtttaatttagctttgctagggaaatggtgttggcggatgttgatggacaaagataatttttggtatagagtgttggtggcgagatatga |
63856 |
T |
 |
| Q |
535 |
tgaggagg |
542 |
Q |
| |
|
|||||||| |
|
|
| T |
63857 |
tgaggagg |
63864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.0000000002; HSPs: 11)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 438 - 492
Target Start/End: Original strand, 31071268 - 31071322
Alignment:
| Q |
438 |
tgagagaatttaatttagctttgctaggtaagtggtgttggatgatgttggttga |
492 |
Q |
| |
|
|||||||||||||| || ||||| | ||||||||||||||||||||||| ||||| |
|
|
| T |
31071268 |
tgagagaatttaatatatctttgttgggtaagtggtgttggatgatgttagttga |
31071322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 507 - 548
Target Start/End: Complemental strand, 26146825 - 26146784
Alignment:
| Q |
507 |
ggtatagggttttggtggcgagatatggtgaggaggatggga |
548 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
26146825 |
ggtatagggtgttggtggcgagatatggcgaggaggatggga |
26146784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 507 - 548
Target Start/End: Complemental strand, 43310869 - 43310828
Alignment:
| Q |
507 |
ggtatagggttttggtggcgagatatggtgaggaggatggga |
548 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
43310869 |
ggtatagggtgttggtggcgagatatggcgaggaggatggga |
43310828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 441 - 488
Target Start/End: Complemental strand, 22863988 - 22863941
Alignment:
| Q |
441 |
gagaatttaatttagctttgctaggtaagtggtgttggatgatgttgg |
488 |
Q |
| |
|
|||||||||||||| ||||| |||| ||||||||||||| |||||||| |
|
|
| T |
22863988 |
gagaatttaatttatctttgttagggaagtggtgttggaggatgttgg |
22863941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 446 - 492
Target Start/End: Complemental strand, 18697886 - 18697840
Alignment:
| Q |
446 |
tttaatttagctttgctaggtaagtggtgttggatgatgttggttga |
492 |
Q |
| |
|
|||||| |||||||| |||| ||||||||||||| |||||||||||| |
|
|
| T |
18697886 |
tttaatgtagctttgttaggaaagtggtgttggaggatgttggttga |
18697840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 443 - 485
Target Start/End: Original strand, 29895261 - 29895303
Alignment:
| Q |
443 |
gaatttaatttagctttgctaggtaagtggtgttggatgatgt |
485 |
Q |
| |
|
||||||||||| |||||| |||||||||||||||||| ||||| |
|
|
| T |
29895261 |
gaatttaatttggctttgttaggtaagtggtgttggaggatgt |
29895303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 220 - 285
Target Start/End: Original strand, 11879014 - 11879079
Alignment:
| Q |
220 |
tttatgtttaatcttgcgattattttaaaatatacgaacgcatagaaatgatcaaagaatattttt |
285 |
Q |
| |
|
|||||||||| || |||||||||||| |||| || ||| ||||| |||||||||| || ||||||| |
|
|
| T |
11879014 |
tttatgtttattcatgcgattattttgaaatgtatgaaagcataaaaatgatcaaggattattttt |
11879079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 442 - 479
Target Start/End: Original strand, 24738861 - 24738898
Alignment:
| Q |
442 |
agaatttaatttagctttgctaggtaagtggtgttgga |
479 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
24738861 |
agaatttaatttagctttactagggaagtggtgttgga |
24738898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 406 - 519
Target Start/End: Original strand, 26894041 - 26894154
Alignment:
| Q |
406 |
agaggagtatgggggtttggggttgagatagttgagagaatttaatttagctttgctaggtaagtggtgttggatgatgttggttgactaaggtgggtta |
505 |
Q |
| |
|
||||||||||| ||||||||| || | |||||| || ||||||||| ||||| |||| || ||||||||| ||||||||| ||| |||||| || |
|
|
| T |
26894041 |
agaggagtatgacggtttgggggtgcggaagttgaaggagtttaatttaactttgttaggaaaatggtgttggcggatgttggtggacataggtggtttg |
26894140 |
T |
 |
| Q |
506 |
cggtatagggtttt |
519 |
Q |
| |
|
||||||||||||| |
|
|
| T |
26894141 |
tggtatagggtttt |
26894154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 406 - 519
Target Start/End: Original strand, 26899480 - 26899593
Alignment:
| Q |
406 |
agaggagtatgggggtttggggttgagatagttgagagaatttaatttagctttgctaggtaagtggtgttggatgatgttggttgactaaggtgggtta |
505 |
Q |
| |
|
||||||||||| ||||||||| || | |||||| || ||||||||| ||||| |||| || ||||||||| ||||||||| ||| |||||| || |
|
|
| T |
26899480 |
agaggagtatgacggtttgggggtgcggaagttgaaggagtttaatttaactttgttaggaaaatggtgttggcggatgttggtggacataggtggtttg |
26899579 |
T |
 |
| Q |
506 |
cggtatagggtttt |
519 |
Q |
| |
|
||||||||||||| |
|
|
| T |
26899580 |
tggtatagggtttt |
26899593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 443 - 492
Target Start/End: Original strand, 42183230 - 42183279
Alignment:
| Q |
443 |
gaatttaatttagctttgctaggtaagtggtgttggatgatgttggttga |
492 |
Q |
| |
|
|||||||||||| ||||| |||| ||||||||||||| | |||||||||| |
|
|
| T |
42183230 |
gaatttaatttatctttgttaggaaagtggtgttggaggttgttggttga |
42183279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0189 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: scaffold0189
Description:
Target: scaffold0189; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 462 - 542
Target Start/End: Complemental strand, 6743 - 6663
Alignment:
| Q |
462 |
taggtaagtggtgttggatgatgttggttgactaaggtgggttacggtatagggttttggtggcgagatatggtgaggagg |
542 |
Q |
| |
|
|||| ||||| ||||||| ||||||||| || ||| || || ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6743 |
taggcaagtgatgttggaggatgttggtagagcgaggcggtttgtggtatagggttttagtggcgagatatggtgaggagg |
6663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179 (Bit Score: 32; Significance: 0.00000001; HSPs: 2)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 409 - 484
Target Start/End: Complemental strand, 8240 - 8165
Alignment:
| Q |
409 |
ggagtatgggggtttggggttgagatagttgagagaatttaatttagctttgctaggtaagtggtgttggatgatg |
484 |
Q |
| |
|
||||| ||| ||||||||| ||||| |||||||||| || ||||| |||||| ||| ||||||||||||| |||| |
|
|
| T |
8240 |
ggagtttggtggtttgggggtgagacagttgagagagttcaatttggctttgttagaaaagtggtgttggaggatg |
8165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 409 - 484
Target Start/End: Complemental strand, 13174 - 13099
Alignment:
| Q |
409 |
ggagtatgggggtttggggttgagatagttgagagaatttaatttagctttgctaggtaagtggtgttggatgatg |
484 |
Q |
| |
|
||||| ||| ||||||||| ||||| |||||||||| || ||||| |||||| ||| ||||||||||||| |||| |
|
|
| T |
13174 |
ggagtttggtggtttgggggtgagacagttgagagagttcaatttggctttgttagaaaagtggtgttggaggatg |
13099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0061 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: scaffold0061
Description:
Target: scaffold0061; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 507 - 545
Target Start/End: Complemental strand, 55272 - 55234
Alignment:
| Q |
507 |
ggtatagggttttggtggcgagatatggtgaggaggatg |
545 |
Q |
| |
|
|||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
55272 |
ggtatagggtgttggtggcgagatatggcgaggaggatg |
55234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0017 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: scaffold0017
Description:
Target: scaffold0017; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 507 - 545
Target Start/End: Original strand, 143362 - 143400
Alignment:
| Q |
507 |
ggtatagggttttggtggcgagatatggtgaggaggatg |
545 |
Q |
| |
|
|||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
143362 |
ggtatagggtgttggtggcgagatatggcgaggaggatg |
143400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0155 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0155
Description:
Target: scaffold0155; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 443 - 492
Target Start/End: Complemental strand, 32839 - 32790
Alignment:
| Q |
443 |
gaatttaatttagctttgctaggtaagtggtgttggatgatgttggttga |
492 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||| | |||||||||| |
|
|
| T |
32839 |
gaatttaatttagctttattagggaagtggtgttggaggttgttggttga |
32790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 507 - 548
Target Start/End: Complemental strand, 28384 - 28343
Alignment:
| Q |
507 |
ggtatagggttttggtggcgagatatggtgaggaggatggga |
548 |
Q |
| |
|
|||||||||| |||||||| |||||||| ||||||||||||| |
|
|
| T |
28384 |
ggtatagggtgttggtggcaagatatggcgaggaggatggga |
28343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University