View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9180_high_4 (Length: 231)
Name: NF9180_high_4
Description: NF9180
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9180_high_4 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 11 - 231
Target Start/End: Original strand, 8227096 - 8227316
Alignment:
| Q |
11 |
gtatggtgttacaaattgatgtgtgattttgtatggaacaaaaaccccggatttagtcatgcttgtaataattgaaataaagcatagaacttcttagata |
110 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8227096 |
gtatgttgttacaaattgatgtgtgattttgtatggaacaaaaaccccggatttagtcatgcttgtaataattgaaataaagcatagaacttcttagata |
8227195 |
T |
 |
| Q |
111 |
attatctaaagaaacttatcatctgatcttcaaattggaagctagtcatttcttcaatctacaatggtcctcattgctgtgggctttgtttgttgctaag |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8227196 |
attatctaaagaaacttattatctgatcttcaaattggaagctagtcatttcttcaatctacaatggtcctcattgctgtgggctttgtttgttgctaag |
8227295 |
T |
 |
| Q |
211 |
attatacttcacaactacttc |
231 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
8227296 |
attatacttcacaactacttc |
8227316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University