View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9181_high_9 (Length: 344)
Name: NF9181_high_9
Description: NF9181
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9181_high_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 184; Significance: 2e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 184; E-Value: 2e-99
Query Start/End: Original strand, 92 - 334
Target Start/End: Complemental strand, 13747087 - 13746842
Alignment:
| Q |
92 |
atagtttcattaggtagtggattgagagtgttttttgaccctaaaggaagagattcannnnnnnnctt---catttgtattacttgtccataagcaggaa |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| || ||||| |||||||||| |||||||||||| |
|
|
| T |
13747087 |
atagtttcattaggtagtggattgagagtgtgttttgaccctaaaggaagagattcattttttttttttttcatttttattacttgtacataagcaggaa |
13746988 |
T |
 |
| Q |
189 |
gtatggcaaaatgtagtgtttggtttacttgtgttttgagctattcttttcaacatatatcaatgatcccgttttctgtctattgttctctttaatacca |
288 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
13746987 |
gtatgacaaaatgtagtgtttggtttacttgtgttttgagctattcttttcaacatatatcaatgatcccgttttctgtctattgttctctttaacacca |
13746888 |
T |
 |
| Q |
289 |
aactacctgtgactgaaaccttttatcgtgaagtaagattatgatg |
334 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13746887 |
aactacctgtgactgaaaccttttatcgtgaagtaagattatgatg |
13746842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University