View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9181_low_21 (Length: 355)
Name: NF9181_low_21
Description: NF9181
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9181_low_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 308; Significance: 1e-173; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 1 - 340
Target Start/End: Complemental strand, 44725235 - 44724896
Alignment:
| Q |
1 |
tcaaactagggttattttcgagtaatgccaatattattgcctcatgcgtatggtggtcttggcgtaaccataaaactcttcttgcttctccaacccatct |
100 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44725235 |
tcaaactagggttattttcaagtaatgccaatattattgcctcatgcgtatggtgatcttggcgtaaccataaaactcttcttgcttctccaacccatct |
44725136 |
T |
 |
| Q |
101 |
atccctcactatcgccttgtcttgaaagcccataatatggcctccgccttcatatcttccttccataattctctgcctataagacacgaggataaatgag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
44725135 |
atccctcactatcgccttgtcttgaaagcccataatatggcctccaccttcatatcttccttccataattctctgcctttaagacatgaggataaatgag |
44725036 |
T |
 |
| Q |
201 |
ttaaatggaacacaccaaatcaaacttacaccatcctcaatactgatgaaagttgtcatggcaaccctattaaagctggattcgacgacttggttccttg |
300 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
44725035 |
ttaaatggaacactccaaatcaaacttacaccatcctcaatactgatgaaagttgtcatggcaaccctattaaagctggattcgacgacttggttcctcg |
44724936 |
T |
 |
| Q |
301 |
gatatctgatttctcaggcctccttggatgaacctctgat |
340 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
44724935 |
gatatgtgatttctcaggcctccttggatgaacctctgat |
44724896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University