View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9181_low_31 (Length: 272)
Name: NF9181_low_31
Description: NF9181
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9181_low_31 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 27 - 255
Target Start/End: Original strand, 44725217 - 44725445
Alignment:
| Q |
27 |
gaaaataaccctagtttgagccaattaatcggatttgtgttggataagaactcggcattagagaagccaaaagcttgccaaagagaacgagaggctaatg |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44725217 |
gaaaataaccctagtttgagccaattaatcggatttgtgttggataagaactcggcattagagaagccaaaagcttgccaaagagaacgagaggctaatg |
44725316 |
T |
|
| Q |
127 |
gatctctaatgcactgaaggaaagattcttcttccgaattgaactgatggcaatgctattgggagccatgttacaatgatgaagcaaaggaatcattgtt |
226 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
44725317 |
gatctctaatgcactgaaggaaatattcttcttccgaattgaactgatggcaatgctattgggagccatgttacaatgatgaagcaaagggatcattgtt |
44725416 |
T |
|
| Q |
227 |
acaaagttgttacaagtcaaccatacaag |
255 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
44725417 |
acaaagttgttacaagtcaaccatacaag |
44725445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University