View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9181_low_35 (Length: 246)
Name: NF9181_low_35
Description: NF9181
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9181_low_35 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 7 - 233
Target Start/End: Complemental strand, 40266141 - 40265916
Alignment:
| Q |
7 |
tagattaatgtcaagcatttgtagtgggacccaaagttccacgtgggagcaaagtggggattggtggagaggagattagaggagattctacttgaggagc |
106 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40266141 |
tagattaatgtcaagcatctgtagtgggacccaaagtcccacgtgggagcaaagtggggattggtggagaggagattagaggagattctacttgaggagc |
40266042 |
T |
 |
| Q |
107 |
accaaacgcaattgtttgcttattacgtggcaatggagccattgttcacgtgacacgtggggcccttaatcnnnnnnnnnnnnnnnngtataatccatag |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
40266041 |
accaaacgcaattgtttgcttattacgtggcaatggagccattgttcacgtgacacgtggggcccttaatc-tttttctttttttttgtataatccatag |
40265943 |
T |
 |
| Q |
207 |
tggcactagtagtaggtaaatttgtct |
233 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
40265942 |
tggcactagtagtaggtaaatttgtct |
40265916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University