View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9181_low_42 (Length: 214)
Name: NF9181_low_42
Description: NF9181
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9181_low_42 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 20 - 202
Target Start/End: Complemental strand, 44357189 - 44357007
Alignment:
| Q |
20 |
gtatactcttaggttagtcatgatctgtcttaagttctaacaataaatctatcaaatatatatgtaacatgtcattacttactatatttctttttattaa |
119 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44357189 |
gtatactcttaggttagttatgatctgtcttaagttctaacaataaatctatcaaatatatatgtaacatgtcattacttactatatttctttttattaa |
44357090 |
T |
|
| Q |
120 |
ttttatgaacaggcttgaaaataatttatcttgcaacgatccaatactccatgttcaatctgctgctcatgttgcctctgctt |
202 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
44357089 |
tcttatgaacaggcttgaaaataatttatcttgcaacgatccaatactccatgttcaatcttctgctcatgttgcctatgctt |
44357007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University