View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9183_high_18 (Length: 398)
Name: NF9183_high_18
Description: NF9183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9183_high_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 350; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 350; E-Value: 0
Query Start/End: Original strand, 18 - 379
Target Start/End: Complemental strand, 52477056 - 52476695
Alignment:
| Q |
18 |
agaggaacttagaatttgagactcttaagagaggactaagttgtgtatgcattgcagatatggattttgcttcaagaccaagttgtttggggaaacccat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
52477056 |
agaggaacttagaatttgagactcttaagagaggactaagttgtgtatgcattgcagatatggaaattgcttcaagaccaagttgtttggggaaacccat |
52476957 |
T |
 |
| Q |
118 |
gttttcatttcgagcaaggagtcagcaaaggtgattctaagaaacgagggagggaaattctcaaagaagtacataaagtcaatctccaagctcttgggtc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52476956 |
gttttcatttcgagcaaggagtcagcaaaggtgattctaagaaacgagggagggaaattctcaaagaagtacataaagtcaatctccaagctcttgggtc |
52476857 |
T |
 |
| Q |
218 |
ccgatagcttgctatgtgcagctgagcatcatcacaaactcattcgtagccgtctcttgagtttgttctcgcctcattctttgccttcctttgttcaact |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52476856 |
ccgatagcttgctatgtgcagctgagcatcatcacaaactcattcgtagccgtctcttgagtttgttctcgcctcattctttgccttcctttgttcaact |
52476757 |
T |
 |
| Q |
318 |
gtttgatgaacttgtaactgaagctacaagtacctggacatgtggatcccttgtcatcatac |
379 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
52476756 |
gtttgatgaacttgtaactgaagctacaggtacctggacatgtggatcccttgtcatcatac |
52476695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University