View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9183_high_38 (Length: 201)
Name: NF9183_high_38
Description: NF9183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9183_high_38 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 3e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 3e-99
Query Start/End: Original strand, 11 - 193
Target Start/End: Original strand, 1174369 - 1174551
Alignment:
| Q |
11 |
aagcagagataatttttgccaaactctatgataacaaaagttgttttgcttgcactacaagaaaatcgcagatacggccaaaaacactcgaaaaggcttc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1174369 |
aagcagagataatttttgccaaactctatgataacaaaagttgttttgcttgcactacaagaaaatcgcagatacggccaaaaacactcgaaaaggcttc |
1174468 |
T |
|
| Q |
111 |
atacctcaggaatgataaattttccagtaagcaagcaaacagcaggaagagtacaatatgcaaccaaaggtattgatgtccat |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1174469 |
atacctcaggaatgataaattttccagtaagcaagcaaacagcaggaagagtacaatatgcaaccaaaggtattgatgtccat |
1174551 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University