View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9185_low_1 (Length: 565)
Name: NF9185_low_1
Description: NF9185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9185_low_1 |
 | |
|
| [»] scaffold0008 (1 HSPs) |
| | |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 7 - 227
Target Start/End: Complemental strand, 42449614 - 42449393
Alignment:
| Q |
7 |
tggtagtatgtcgagtttggtaaattgaagtc-aacggaagagattaacatacaaggaggattgaagcaaggggacccgcttgcttctttcttgtttctt |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
42449614 |
tggtagtatgtcgagtttggtaaattgaagtccaacggaagagattaacatacaaagaggattgaagcaaggggacccccttgcttctttcttgtttctt |
42449515 |
T |
|
| Q |
106 |
caagtggcgaaatgatttagtgggttgatgaagaatgtagtgaaccttaatatgtttaaggggttcaagtttacgagggaggggatgaagatttctcatt |
205 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42449514 |
caagtggtgaaatgatttagtgggttgatgaagaatgtagtgaaccttaatatgtttaaggggttcaagtttacgagggaggggatgaagatttctcatt |
42449415 |
T |
|
| Q |
206 |
tacaatttgtcgacgacactct |
227 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
42449414 |
tacaatttgtcgacgacactct |
42449393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 379 - 437
Target Start/End: Original strand, 20696372 - 20696430
Alignment:
| Q |
379 |
ttttttaattgttgtgaaggtagtatccctttcaagtatttgggactaccaatgggggc |
437 |
Q |
| |
|
||||| |||||| || |||| |||||||| ||||||||||||||| ||||| ||||||| |
|
|
| T |
20696372 |
tttttgaattgtagtcaagggagtatcccgttcaagtatttgggattaccagtgggggc |
20696430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: scaffold0008
Description:
Target: scaffold0008; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 379 - 439
Target Start/End: Original strand, 58275 - 58335
Alignment:
| Q |
379 |
ttttttaattgttgtgaaggtagtatccctttcaagtatttgggactaccaatgggggcta |
439 |
Q |
| |
|
|||||||||||| ||||||||||| |||| |||||||||||||| |||| ||||||||| |
|
|
| T |
58275 |
ttttttaattgtagtgaaggtagtctcccgttcaagtatttggggttaccggtgggggcta |
58335 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University