View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9185_low_7 (Length: 253)
Name: NF9185_low_7
Description: NF9185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9185_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 54380612 - 54380837
Alignment:
| Q |
1 |
cctttaattaatcccatatgcacaattatgtaaggtttacccatttccttgtgatcctgtgtttc---gccctgtaagacgagggtaaaattaggtaaat |
97 |
Q |
| |
|
||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
54380612 |
ccttttattaataccatatgcacaattatgtaaggtttacccatttccttgtgatcctgtgtttctgtgccctgtaagacgagggtaaaattaggtaaat |
54380711 |
T |
 |
| Q |
98 |
tgggtttgtagtttgtagaatttcaaactttgattttgtaggtgtgcaattgaggcatatgaagcaccatat-----tttgtgagaatcatcttgattgt |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
54380712 |
tgggtttgtagtttgtagaatttcaaactttgattttgtaggtttgcaattgaggcatatgaagcaccatattccgatttgtgagaatcatcttgattgt |
54380811 |
T |
 |
| Q |
193 |
gtgatttataagtatgcttcttttta |
218 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
54380812 |
gtgatttataagtatgcttcttttta |
54380837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University