View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9186_low_27 (Length: 281)

Name: NF9186_low_27
Description: NF9186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9186_low_27
NF9186_low_27
[»] chr4 (1 HSPs)
chr4 (72-268)||(41292664-41292860)


Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 72 - 268
Target Start/End: Original strand, 41292664 - 41292860
Alignment:
72 tcaagaagaaaaatattgtcatacgtgaaactaattattttcatttgaaataaatacaaccaaaagtaaaataccatttgtggaatactaacatgacagt 171  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |    
41292664 tcaagaagaaaaatattgtcatacgtgaaactaattattttcatttgaaataaatacaaccaaaagtaaaataccatttgtggaatactaacatgacaat 41292763  T
172 tgcaattgcctgtttaccaccccaacacagctggaataaaaatcatagccacgggcttgtatcttttgctcatctttattgctttttctataaagta 268  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41292764 tgcaattgcctgtttaccaccccaacacagctggaataaaaatcatagccacgggcttgtatcttttgctcatctttattgctttttctataaagta 41292860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University