View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9187_high_4 (Length: 269)
Name: NF9187_high_4
Description: NF9187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9187_high_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 80 - 258
Target Start/End: Complemental strand, 52344295 - 52344117
Alignment:
| Q |
80 |
atatatatcatgtactatacacatacatgcagggatgtgatgcatcagcattgttagacgacacatcaaatttcacaggagagaagaacgcatttccaaa |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52344295 |
atatatatcatgtactatacacatacatgcagggatgtgatgcatcagcattgttagacgacacatcaaatttcacaggagagaagaacgcatttccaaa |
52344196 |
T |
 |
| Q |
180 |
tgcaaattcgctaagaggttttgagttaatagatgacatcaaatctcaattggaggatatgtgtcccaataccgtctct |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
52344195 |
tgcaaattcgctaagaggttttgagttaatagatgacatcaaatctcaattggaggatatgtgtcccaatactgtctct |
52344117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 105 - 234
Target Start/End: Complemental strand, 9155685 - 9155556
Alignment:
| Q |
105 |
catgcagggatgtgatgcatcagcattgttagacgacacatcaaatttcacaggagagaagaacgcatttccaaatgcaaattcgctaagaggttttgag |
204 |
Q |
| |
|
||||||||||||||||| ||||| |||| |||||||||| |||| ||||| ||| |||||||| | || | ||| ||||| |||||||||||||||||| |
|
|
| T |
9155685 |
catgcagggatgtgatggatcagtattgctagacgacacgtcaagtttcaaaggtgagaagaattctttacaaaacgcaaactcgctaagaggttttgag |
9155586 |
T |
 |
| Q |
205 |
ttaatagatgacatcaaatctcaattggag |
234 |
Q |
| |
|
||||| || |||||||||||| ||||||| |
|
|
| T |
9155585 |
ttaattgacgacatcaaatctacattggag |
9155556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 110 - 155
Target Start/End: Original strand, 26960872 - 26960917
Alignment:
| Q |
110 |
agggatgtgatgcatcagcattgttagacgacacatcaaatttcac |
155 |
Q |
| |
|
|||||||||||||||||| | |||||||||| ||||||| |||||| |
|
|
| T |
26960872 |
agggatgtgatgcatcagtactgttagacgatacatcaagtttcac |
26960917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 107 - 165
Target Start/End: Original strand, 27202093 - 27202151
Alignment:
| Q |
107 |
tgcagggatgtgatgcatcagcattgttagacgacacatcaaatttcacaggagagaag |
165 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |||| ||||| ||||||||| |
|
|
| T |
27202093 |
tgcagggatgtgatgcatcagtcctgttagacgacacttcaagcttcaccggagagaag |
27202151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University