View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9187_low_11 (Length: 267)

Name: NF9187_low_11
Description: NF9187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9187_low_11
NF9187_low_11
[»] chr4 (1 HSPs)
chr4 (125-252)||(51776710-51776837)


Alignment Details
Target: chr4 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 125 - 252
Target Start/End: Complemental strand, 51776837 - 51776710
Alignment:
125 gaactacaacctcgatcttttctccattttcaatttcaatggctaccacttcttcttcactctacacgtggcttgaaccatcttgcatgtcagtcacgtg 224  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51776837 gaactacaacctcgatcttttctccattttcaatttcaatggctaccacttcttcttcactctacacgtggcttgaaccatcttgcatgtcagtcacgtg 51776738  T
225 cgaagctgaccgtatcagaacatctttt 252  Q
    ||||||||||||||||||||||||||||    
51776737 cgaagctgaccgtatcagaacatctttt 51776710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University