View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9188_low_5 (Length: 286)
Name: NF9188_low_5
Description: NF9188
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9188_low_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 31 - 270
Target Start/End: Original strand, 55171038 - 55171277
Alignment:
| Q |
31 |
gaccgttgaagtttgcacggttcacttcaaccaaacattcttctttccccaagcatgccttctcaacaacacccttagcagcaccaccgttacaatttcc |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55171038 |
gaccgttgaagtttgcacggttcacttcaaccaaacattcttctttccccaagcatgccttctcaacaacacccttagcagcaccaccgttacaatttcc |
55171137 |
T |
 |
| Q |
131 |
aatagcaaaatctccacagtaaccactaggattaccaaagcttgcaaactcgacagcaacaatcttttttccgctgggacatttcagtgaagcttgtggt |
230 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
55171138 |
aagagcaaaatctccacagtaaccactaggattaccaaagcttgcaaactcgacagcaacaatctttttgccgctgggacatttcagtgaagcttgtggt |
55171237 |
T |
 |
| Q |
231 |
ccagaatttttgccaacagaacgaaattctccgttcttag |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55171238 |
ccagaatttttgccaacagaacgaaattctccgttcttag |
55171277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University