View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9189_low_10 (Length: 336)
Name: NF9189_low_10
Description: NF9189
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9189_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 10 - 244
Target Start/End: Original strand, 21880079 - 21880313
Alignment:
| Q |
10 |
gtttcgtgttgattttttcggaacaatgaatgttccctatttgcttctggaaaacgcttcgctcttccacgacgtcgtatctcacaaaggcgcttctaca |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21880079 |
gtttcgtgttgattttttcggaacaatgaatgttccctatttgcttctggaaaacgcttcgctcttccacgacgtcgtatctcacaaaggcgcttctaca |
21880178 |
T |
 |
| Q |
110 |
gactttggctattgttggactccggtcctagaattaccctcttcaccctagaaaatattactccatttgttttccactttattatcatttcacgcgccta |
209 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
21880179 |
gacttgggctattgttggactccgatcctagaattaccctcttgaccctagaaaatattactccatttcttttccactctattatcatttcacgcgccta |
21880278 |
T |
 |
| Q |
210 |
tttttctccgaaaatattatttattcaaattatat |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
21880279 |
tttttctccgaaaatattatttattcaaattatat |
21880313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University